<?xml version="1.0" encoding="utf-8"?>



<feed xmlns="http://www.w3.org/2005/Atom"
    xmlns:fh="http://purl.org/syndication/history/1.0"
    xmlns:at="http://purl.org/atompub/tombstones/1.0">

    <title>Mullins Molecular Retrovirology Lab: Protocols</title>
    <subtitle>A personal publishing system for the modern web</subtitle>
    <link href="https://viroverse.washington.edu/protocols/feed" rel="self" />
    <link href="https://viroverse.washington.edu/protocols/feed" rel="current" />
    <link href="https://pubsubhubbub.superfeedr.com" rel="hub" />
    
    <link href="https://viroverse.washington.edu/protocols/microarrays/feed?date=2010-03" rel="prev-archive" />
    
    
    <link href="https://viroverse.washington.edu/protocols/" />
    
    <id>tag:viroverse.washington.edu,2019-03-04:protocols</id>
    <updated>2015-05-05T14:22:47+00:00</updated>

    
    <entry>
        <title>Pairwise growth competition assay</title>
        <link href="https://viroverse.washington.edu/protocols/tissue_culture_bl3/1725-Pairwise-growth-competition-assay" rel="alternate" type="text/html" />
        <published>2015-05-05T14:13:26-07:00</published>
        <updated>2015-05-05T14:22:47+00:00</updated>
        <id>urn:uuid:ed10a9a2-4181-58c9-b03e-9c3848083db1</id>
        <author><name>Mullins Admin</name></author>
        <content type="html">
<![CDATA[
<p><a href="https://www.jove.com/video/52610/pairwise-growth-competition-assay-for-determining-replication-fitness" title="Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses">Pairwise Growth Competition Assay for Determining the Replication
Fitness of Human Immunodeficiency
Viruses</a></p><p><strong>PROTOCOL:</strong></p><p><strong>*For figures and references, please check the paper
(</strong><a href="http://www.jove.com/video/52610"><strong>http://www.jove.com/video/52610</strong></a><strong>)
or the video</strong></p><p>This protocol is <a href="https://mullinslab.microbiol.washington.edu/protocols/Mullins-Manocheewa-Pairwise-growth-competition-assay.docx">also available as a Word
document</a>.</p><p>**<br>
**</p><p><strong>1)</strong> <strong>Construction of chimeric HIV-1 NL4-3 molecular clones</strong>  </p>
<hr>
<p><strong>1.1)</strong> <strong>Amplify insert DNA fragment</strong></p><p>1.1.1) Design chimeric primers. The 5&#39; halves of both forward and
reverse primers contain an HIV-1 vector sequence, at which the fragment
will be inserted. The 3&#39; half of the primers must contain the end of the
insert sequence (<strong>Figure 2</strong>). Make sure that the chimeric primer
sequence retains the original open reading frames.</p><p>1.1.1.1) Use primers at least 20 bases in length, with a melting
temperature greater than or equal to 60 Â°C, ~50% GC content, and a low
tendency to form primer dimers, heterodimers and/or hairpin structures.
These properties can be assessed using the OligoAnalyzer web tool
(https://www.idtdna.com/analyzer/Applications/OligoAnalyzer/)</p><p>1.1.2) Use PCR<sup>27</sup> and the chimeric primers to amplify insert
DNA (<strong>Figure 2</strong>). For each PCR reaction, use 1X high fidelity buffer,
0.2 mM dNTPs, 1 U high fidelity DNA polymerase, 0.5 ÂµM of forward
chimeric primer, 0.5 ÂµM of reverse chimeric primer, and 1 pg - 10 ng of
DNA sample carrying insert region. Add dH<sub>2</sub>O to a final volume
of 50 Âµl.</p><p>1.1.3) Set thermal cycling steps as follows: Perform an initial DNA
denaturation step at 98 Â°C for 10 sec. Amplify with 30 cycles of DNA
denaturation at 98 Â°C for 10 sec and DNA annealing at 3 Â°C above the
lowest melting temperature of the two primers for 20 sec. Perform a
final extension at 72 Â°C for 10 min. Store PCR products at 4 Â°C.</p><p>1.1.4) Take 5 Âµl of the PCR products from the previous step and run
agarose gel electrophoresis<sup>28</sup>.</p><p>1.1.4.1) Use a 0.7% agarose gel, 1X TAE buffer (40 mM Tris-acetate, 1 mM
EDTA), 0.5 Î¼g/ml ethidium bromide (EtBr) final concentration and 1 kb
ladder as the DNA size marker. Set power source voltage to 5 V/cm
distance between electrodes. Stop the electrophoresis when the loading
dye migrates through about 2/3 of the gel length. Visualize the gel
using a gel documentation system<sup>28</sup>.</p><p>Note: EtBr is a suspected carcinogen and must be properly disposed of,
per institution regulations. Gloves should always be worn when handling
gels containing EtBr. Change to new gloves after finish handling EtBr
containing material and before handling other materials or equipment to
prevent cross contamination.</p><p>1.1.5) If only one DNA band with size corresponding to the desired PCR
product is detected, purify the rest of the PCR product using a
commercial kit such as QIAquick PCR Purification Kit according to the
manufacturer&rsquo;s protocols.</p><p>1.1.5.1) If other, non-specific bands are also present, use the rest of
the PCR product to run preparative gel electrophoresis. Use the same
parameters and conditions specified in step 1.1.4. Ensure that the gel
well is large enough to load ~45 Âµl of PCR products. Cut out the band
of interest and extract the DNA from the gel using QIAquick gel
extraction kit according to the manufacturer&rsquo;s protocols.  </p><p><strong>1.2)</strong> <strong>Introduce the insert fragment into full-length infectious
HIV-1 subtype B vector (pNL4-3)</strong></p><p>1.2.1) Use purified PCR products from step 1.1.5 as PCR primers. Use
pNL4-3VifA<sup>20</sup> as template DNA in one PCR reaction and use
pNL4-3VifB<sup>20</sup> as template in the other reaction (<strong>Figure
2</strong>). For each PCR reaction, use 1X high fidelity buffer, 0.2 mM dNTPs,
2 U high fidelity DNA polymerase, 500 ng of primer DNA and 50 ng of
template DNA in a final volume of 50 Âµl. Set the thermal cycling
parameters to: 98 Â°C for 30 sec, 35 cycles at 98 Â°C for 10 sec, 48 Â°C
for 1 min and 72 Â°C for 10 min, followed by 72 Â°C for 10 min.  </p><p>1.2.2) Add 10 U of <em>Dpn</em>I to 50 Âµl of the PCR reaction and incubate at
37 <sup>o</sup>C for 1 hr to digest the template DNA. Ensure that the
plasmid DNA is isolated from a methylation competent bacterial strain,
e.g., TOP10 chemically competent <em>Escherichia coli</em>.*  </p><p>*</p><p>1.2.3) Use <em>Dpn</em>I digested product to transform competent bacterial
cells. Use heat-shock transformation with TOP10 chemically competent <em>E.
coli</em>, according to the manufacturer&rsquo;s protocol. To select for bacterial
cells containing the recombinant plasmid, use Luria Broth (LB) culture
plates containing 100 mg/L carbenicillin.  </p><p>1.2.3.1) Pick ~10 well-separated colonies and grow each separately in 3
ml LB liquid medium containing 100 mg/L carbenicillin and incubate at 30
Â°C in a shaker overnight.*  </p><p>*</p><p>1.2.3.2) Use QIAprep Spin Miniprep kit to isolate plasmid DNA from the
bacterial liquid culture, according to the manufacturer&rsquo;s protocol.</p><p>1.2.4) Use double restriction digestion<sup>29</sup> to determine
whether the plasmid DNA contains the proper ** insert. Ensure that one
of the restriction sites exists only within the insert region and the
other restriction site exists only once in the HIV-1 vector, outside of
the insert region.</p><p>1.2.4.1) Digest at least 300 ng of plasmid DNA in a 10 Âµl final
reaction volume. Select restriction buffers, incubation temperature and
incubation time according to the manufacturer&rsquo;s protocol of the selected
restriction enzymes. Take 9 Âµl of the digested DNA and run gel
electrophoresis as described in step 1.1.4. Select recombinant plasmids
that have DNA bands of the predicted sizes.  </p><p>1.2.5) Confirm sequence integrity of the recombinant plasmids by Sanger
sequencing. While rare, unwanted mutation(s) can be introduced during
the PCR reactions.</p><p>1.2.5.1) Sequence both strands of the plasmid DNA. Follow instructions
in step 1.1.1.1 to design sequencing primers. In addition, ensure that
the forward and reverse sequencing primers anneal at least 50 bp
upstream and downstream of the insert region in the recombinant plasmid,
respectively.</p><p>1.2.5.2) Submit plasmid DNA and sequencing primers to a commercial DNA
sequencing service provider. Prepare DNA sample and primers as specified
by the service provider.</p><p>1.2.6) Make an endotoxin-free stock of the mutated plasmid DNA using an
Endotoxin free plasmid DNA kit according to manufacturer&rsquo;s protocol.
Prepare at least 1 Âµg of endotoxin-free plasmid DNA for transfection in
the following step.</p><p><strong>1.3)</strong> <strong>Introduce small-scale mutations via site-directed
mutagenesis</strong></p>
<hr>
<p>1.3.1) Design mutagenic primers with overlapping forward and reverse
primers containing the desired mutation(s). Position the base(s) to be
substituted, inserted, or deleted in the middle of the primers, flanked
by 10-15 homologous bases. Follow instructions in step 1.1.1.1.</p><p>1.3.2) Use PCR to synthesize mutant plasmids. For each PCR reaction, use
1X high fidelity buffer, 10 mM dNTPs, 2 U of high fidelity DNA
polymerase, 0.5 ÂµM of forward mutagenic primer, 0.5 ÂµM of reverse
mutagenic primer and 50 ng of chimeric pNL4-3VifB, from step 1.2.6, in a
final volume of 50 Âµl. Set the thermal cycling parameters to: 98 Â°C
for 30 sec, 25 cycles at 98 Â°C for 10 sec, 48 Â°C for 1 min and 72 Â°C
for 10 min, followed by 72 Â°C for 10 min.</p><p>1.3.3) Repeat step 1.2.2 to 1.2.6.</p><p><strong>2)</strong> <strong>Generation of viral stock using transfection</strong></p><p>2.1) Calculate the amount of viral stock desired and plasmid DNA
required. With a viral titer of 10<sup>4</sup> IU/ml or higher, 1.8 ml
of viral stock is sufficient for two sets of growth competition assays,
including monoinfections, each done in triplicate. For a transfection
done in a 6-well plate, about 1.8 ml supernatant is harvested per well.
One Âµg of plasmid DNA is needed for each transfection done in a 6-well
plate.  </p><p>2.2) For each well of a 6-well plate, prepare 100 Âµl of transfection
mixture, e.g., consisting of 1 Âµl X-tremeGENE 9 transfection reagent
(or comparable product), 1 Âµg of plasmid DNA and serum-free DMEM.</p><p>2.2.1) Determine the volume of plasmid DNA needed, using 1 Âµg plasmid
DNA per well. Ensure that the final concentration of the plasmid DNA is
at least 50 ng/Âµl.  </p><p>2.2.2) Determine how much serum-free medium (DMEM) is needed per well
using the formula: Total volume of DMEM in Âµl = 100 ÂµL - DNA volume in
Âµl.  </p><p>2.3) Add 10<sup>6</sup> HEK 293T-17 (ATCC) cells/well in 2 ml of
propagation medium (DMEM + 10% fetal bovine serum (FBS)) into a 6-well
plate. Incubate for 1 hr at 37 <sup>o</sup>C in a 5% CO<sub>2</sub>
atmosphere. Seed as many wells as needed (determined in step 2.1).  </p><p>2.4) To prepare the transfection mixture, aliquot the appropriate volume
of serum-free DMEM, as calculated above, into a 1.8 ml polypropylene
microcentrifuge tube, and then add the transfection reagent.  </p><p>2.4.1) Pipette reagent directly into the media solution, do not add it
to the plastic surface of the microcentrifuge tube. Add plasmid DNA
last. Pipet up and down gently to mix the solution. Incubate for 15 min
at room temperature (15 <sup>o</sup>C to 25 <sup>o</sup>C) to allow the
formation of transfection complexes.  </p><p>2.4.2) Add the mixture in a drop-wise manner to cells seeded in the
6-well plate. Gently shake or swirl the wells to ensure even
distribution of transfection complexes.  </p><p>2.4.3) Seal plates with plastic wrap.  </p><p>2.5) Incubate cultures at 37 <sup>o</sup>C in a 5% CO<sub>2</sub>
atmosphere for 48
hr.<span id="Wash_optional"></span><span id="Harvest_day_2"></span>  </p><p>2.6) Use a pipette to carefully collect and transfer supernatant to a 15
ml tube through a 0.22 Âµm filter top<em>.</em>  </p><p>2.7) Use pipette to transfer 250 Âµl or more of the filtered supernatant
to 1.8 ml microfuge tubes with rubber gaskets in the lids.  </p><p>2.8) Store filtered supernatants at -80 <sup>o</sup>C until use.**</p>
<hr>
<p><strong>3)</strong> <strong>Determine infectious titer of viral stocks on peripheral blood
mononuclear cells (PBMCs)</strong></p>
<hr>
<p>3.1) Stimulate PBMCs with phytohemagglutinin (PHA). Per one viral stock,
seed 2 x 10<sup>6</sup> PBMCs in complete Iscove&rsquo;s Modified Dulbecco&rsquo;s
Medium (cIMDM; IMDM supplemented with 20 U/ml of human interleukin 2
(hIL-2), 10% fetal bovine serum and 1% penicillin/streptomycin)
supplemented with PHA (1.5 Âµg/ml). Seed PBMCs at 2 x 10<sup>6</sup>
cells/ml. Incubate PBMCs at 37 <sup>o</sup>C in a 5% CO<sub>2</sub> ****
atmosphere **** for 72 hr.</p><p>3.2) Harvest PHA stimulated PBMCs. Transfer non-adherent PHA-PBMCs to a
50 ml conical tube. Spin tube at 228 x g for 10 min. Carefully remove
supernatant without disrupting the cell pellet. Re-suspend the cell
pellet to a final concentration of 2 x 10<sup>5</sup> PBMCs/ml in cIMDM.</p><p>3.3) Seed 2x10<sup>4</sup> PHA stimulated PBMCs/well in 100 Âµl/well
cIMDM in a round bottom 96-well plate.  </p><p>3.4) Make a 1:10 dilution of the viral stock. Then, from the first
diluted stock, make twelve 3-fold serial dilutions in a 96-well master
plate. This dilution scheme is recommended for detecting viral titers in
the range of 10<sup>4</sup> to 10<sup>6</sup> infectious unit (IU) per
ml. For example, add 20 Âµl of virus stock to 180 Âµl media in the 1.5
ml tube. Mix the dilution by pipetting carefully. Then transfer 90 Âµl
of the diluted stock into 180 Âµl media of the first well and mix well
by pipetting. Continue dilution series by transferring 90 Âµl from the
current well to 180 Âµl media in the next well eleven more times.
Increase or decrease the initial dilution if titers higher than
10<sup>6</sup> IU/ml or lower than 10<sup>4</sup> IU/ml are expected,
respectively.  </p><p>3.5) Add 40 Âµl of the serially diluted viral stock from the master
dilution plate to the seeded PBMCs plate (from step 3.3) in
quadruplicate. Incubate plates at 37 <sup>o</sup>C in a 5%
CO<sub>2</sub> **** atmosphere **** for 16-24
hr.<span id="d1_wash_optional"></span>  </p><p>3.6) Carefully remove 100 Âµl supernatant from each well, and replace
with 160 Âµl fresh cIMDM to a total volume of 200 Âµl/well. Incubate
plates at 37 <sup>o</sup>C with 5% CO<sub>2</sub> **** atmosphere (day
1).  </p><p>3.7) On days 4, 7, 10 and 13
<span id="d2_4_7_10_treatment"></span>transfer 100 Âµl supernatant from
each well to 100 Âµl disruption buffer (2 % TritonX-100 in PBS), and
replace with 100 Âµl fresh cIMDM. Store the supernatants at -20
<sup>o</sup>C.</p><p>3.7.1) Keep sampling and adding fresh cIMDM every three days until the
titer stabilizes.</p><p>3.8) Determine the 50% tissue culture infectious dose
(TCID<sub>50</sub>) of the viral stock by p24 ELISA using the day 7 and
13 samples as described in step 4.</p><p>3.8.1) If the TCID<sub>50</sub> obtained from day 13 is clearly higher
than the titer from day 7, the virus stock may need a longer time to
expand. Repeat the p24 ELISA using later samples until the infectious
titers from two sampling time points become stable (or decrease). Stocks
should be selected from samples with the highest titers.  </p><p>4) **ELISA (Enzyme-linked Immunoabsorbant assay) detection of HIV-1 p24
for determining viral infectious titer  </p><p>**Note: The following protocol was developed using p24 antigen capture
plates prepared in our laboratory<sup>30</sup>. Commercial HIV-1 p24
ELISA plate/kits can also be used, following the manufacturer&rsquo;s
protocol.  </p><p>4.1) Prior to working with samples, prepare working stocks of primary
antibody (rabbit anti-HIV-1 SF2 p24 antiserum).</p><p>4.1.1) Thaw p24 antiserum at room temperature (RT).</p><p>4.1.2) Mix 2.5 ml glycerol with 2 ml 10% FBS in phosphate buffer saline
(PBS).</p><p>4.1.3) Add 0.5 ml antiserum and mix.</p><p>4.1.4) Store 1 ml aliquots at -20 <sup>o</sup>C.</p><p>4.2) Thaw samples from step 3.7 in 37 <sup>o</sup>C incubator.</p><p>4.3) Wash the p24 capture plate 5 times with wash buffer (1x PBS with
0.05% Tween-20).  </p><p>4.4) Add 50 Âµl/well of sample diluent (1% bovine serum albumin (BSA),
0.2% Tween-20 in RPMI-1640), then add 50 Âµl of sample to appropriate
wells. Include at least three wells with sample diluent only as mock /
negative controls. Incubate for 2 hr at 37 <sup>o</sup>C or overnight at
4 <sup>o</sup>C.</p><p><span id="Add_primary_Ab"></span>4.5) Prepare the primary antibody
solution fresh before use. Make a 1:2,000 fold dilution of the primary
antibody working stocks using the primary antibody diluent (12% FBS in
RPMI-1640). Ensure to prepare enough for the use of 100 Âµl solution per
each sample/control well in a 96-well plate.</p><p>4.5.1) For example, to make enough solution for one 96-well plate, add 5
Âµl of the primary antibody working stocks to the primary antibody
diluent for a final volume of 10 ml.</p><p>4.6) Wash capture plate 5 times with wash buffer.  </p><p>4.7) Add 100 Âµl of the primary antibody solution to each well. Incubate
for 1 h at 37 <sup>o</sup>C in a 5% CO<sub>2</sub> atmosphere.  </p><p><span id="Add_secondary_Ab"></span>4.8) Prepare the secondary antibody
solution fresh before use. Make a 1:14,400 fold dilution of the
secondary antibody (1 mg/ml Goat anti-rabbit HRP) using the secondary
antibody diluent (7 % FBS, 0.01 % Tween-20 in RPMI-1640). To reduce
pipetting errors, perform a two-step serial dilution. Ensure to prepare
enough for the use of 100 Âµl solution per each sample/control well in a
96-well plate.</p><p>4.8.1) For example, to make enough solution for one 96-well plate, first
add 1 Âµl of the secondary antibody to 99 Âµl of the secondary antibody
diluent. Then add 70 Âµl of first dilution to the secondary antibody
diluent for a final volume of 10 ml.  </p><p>4.9) Wash capture plate 5 times with wash buffer.  </p><p>4.10) Add 100 Âµl of the secondary antibody solution to each well.
Incubate for 1 hr at 37 <sup>o</sup>C in a 5% CO<sub>2</sub>
atmosphere.  </p><p>4.11) Wash plate 5 times with wash buffer.  </p><p>4.12) Add<span id="Add_substrate"></span> 100 Âµl of room temperature
TMB substrate. Incubate 30 min at room temperature in a closed container
to protect from light.  </p><p><span id="Add_stop"></span>4.13) Add 100 Âµl of room temperature stop
solution (1 N H<sub>2</sub>SO<sub>4</sub>).  </p><p>4.14) Read absorbance at 450-650 nm in each well using a microplate
reader. Use the absorbance value to score each well as infected or
uninfected. A well is considered to contain infectious virus if the
absorbance value is at least three times higher than the value read from
mock / negative control wells. Calculate TCID<sub>50</sub> of the viral
stock using the Reed-Meunch method<sup>31</sup>.  </p><p>5) **Establish viral growth kinetics  </p><p>**</p><p><span id="d14_treatment"></span><span id="Suppliments"></span><strong>5.1)</strong>
<strong>Monoinfection</strong></p><p>5.1.1) Seed 3x10<sup>5</sup> PHA-stimulated PBMC/well in 48-well plates
in a total volume of 500 Âµl/well. Keep the culture plates at 37
<sup>o</sup>C in a 5% CO<sub>2</sub> atmosphere until inoculation.  </p><p>5.1.2) For each virus, prepare an inoculum containing 6,000 IU in 2 ml
of cIMDM.  </p><p>5.1.3) Inoculate wells in triplicate by adding 500 Âµl of the inoculum
(1,500 IU) to the seeded cells. The final volume of the infected cell
culture is 1 ml/well and the MOI is 0.005.  </p><p>5.1.4) Aliquot 200 Âµl of the remaining inoculum to each of two 96-well
plates for RNA isolation, one of which is saved as a backup.  </p><p>5.1.5) Incubate cultures at 37 <sup>o</sup>C in a 5% CO<sub>2</sub>
atmosphere for 16-24 h.  </p><p>5.1.6) Wash cultures 16-24 h after inoculation.</p><p>5.1.6.1) Remove and discard 750 Âµl of culture supernatant.  </p><p>5.1.6.2) Add 750 Âµl of fresh cIMDM. Wrap plates in plastic wrap and
spin for 10 minutes at 300 x g. Remove and discard 750 Âµl
supernatant.  </p><p>5.1.6.3) Add 750 Âµl of fresh cIMDM. Incubate at 37 <sup>o</sup>C with a
5% CO<sub>2</sub> atmosphere (day 1)**.  </p><p>**</p><p><span id="Daily_Treatment"></span>5.1.7) Sample cultures daily from day
2 to day 7.  </p><p>5.1.7.1) Transfer 500 Âµl of culture supernatant to a 1.8 ml centrifuge
tube. Spin for 1 min at 3000 x g.  </p><p>5.1.7.2) Transfer 200 Âµl of the cell-free supernatant to the two
96-well sample plates for RNA isolation, again saving one plate as
backup. Store supernatants at -80 <sup>o</sup>C until RNA isolation.  </p><p>5.1.7.3) Add 500 Âµl fresh cIMDM to each culture. Incubate at 37
<sup>o</sup>C in a 5% CO<sub>2</sub> atmosphere.  </p><p>5.1.7.4) Discard cultures into Wescodyne at the end of the experiment.  </p><p>5.1.7.5) Isolate RNA from 200 Âµl of supernatant (use commercial kits
such as QIAamp Viral RNA Mini Kit) following the manufacturer&rsquo;s standard
protocol. For a large number of samples, use the Qiagen QIAxtractor.  </p><p>5.1.7.6) Store RNA samples at -80 <sup>o</sup>C until cDNA synthesis.  </p><p><strong>5.2)</strong> <strong>cDNA synthesis (Reverse transcription)</strong></p><p>5.2.1) For each RNA sample, add 1.2 nmol of dNTP and 1.2 pmol of cDNA
synthesis primer, (5&#39;-GTTGATCCTTTAGGTATCTTTCCACAGC-3&#39;, HXB2 nucleotide
7968 to 7995) to 10 Âµl of viral RNA. Add water to a final volume of 14
Âµl. Flick the tube to mix and spin briefly to collect liquid at the
bottom of the tube.  </p><p>5.2.2) Incubate mixture for 5 min at 65 <sup>o</sup>C, then hold at 4
<sup>o</sup>C until the master mix is prepared.  </p><p>5.2.3) Prepare master mix using 5x first-strand buffer (250 mM Tris-HCl,
pH 8.3, 375 mM KCl, 15 mM MgCl<sub>2</sub>), 5 mM DTT, 120 U of
SuperScriptIII and 240 U of Rnase inhibitor. Add water to final volume
of 10 Âµl.  </p><p>5.2.4) Add 10 Âµl of master mix to RNA mixture, flick to mix and spin to
collect.  </p><p>5.2.5) Incubate mixture for 90 min at 50 <sup>o</sup>C to allow
synthesis of cDNA. Incubate for 15 minutes at 70 <sup>o</sup>C to
inactivate reverse transcriptase. Hold at 4 <sup>o</sup>C as needed.  </p><p>5.2.6) Add 2 U of Rnase H, flick to mix, and then spin to collect.  </p><p>5.2.7) Incubate 20 min at 37 <sup>o</sup>C. Store cDNA at -20
<sup>o</sup>C.  </p><p><strong>5.3)</strong> **cDNA quantitation using qPCR system  </p><p>**</p><p>5.3.1) Prepare a standard dilution series. Do 10-fold serial dilution,
from 3 x 10<sup>6</sup> copies/Âµl down to 30 copies/Âµl, of pNL4-3VifA.
Use distilled water for dilutions. Prepare the standard dilution series
fresh before use or prepare small batches and keep at -20 <sup>o</sup>C.
Do not freeze-thaw the standards more than three times.</p><p>5.3.2) Set up a 96-well qPCR reaction plate. Ensure that each plate
contains at least one well of negative controls, a triplicate of the
standard dilution series, and at least a duplicate of each cDNA sample.</p><p>5.3.3) For each qPCR reaction, use 12.5 Âµl of qPCR master mix, 0.2 ÂµM
probe, 0.8 ÂµM each of the forward and reverse primers and 1 Âµl of cDNA
or the standard dilution series or water/buffer (for the negative
control well). Add water to a final volume of 25 Âµl. The qPCR probe is
light sensitive. Keep it in closed container.</p><p>5.3.3.1) To detect cDNA derived from pNL4-3VifA based molecular clone,
use the VifA primer-probe: VifAB forward primer
(GGTCTGCATACAGGAGAAAGAGACT), VifA reverse primer
(5&#39;-AGGGTCTACTTGTGTGCTATATCTCTTTT-3&#39;) and VifAB probe
(6FAM-5&#39;-CTCCATTCTATGGAGACTC-3&#39;-MGBNFQ). For cDNA derived from
pNL4-3VifB based clone, use the VifB primer-probe: VifAB forward primer,
VifAB probe and VifB reverse primer (5&#39;-CACCTGCGTGCTATACCTTTTCT-3&#39;).  </p><p>5.3.4) Set PCR cycling parameters to 50 <sup>o</sup>C for 2 min, 95
<sup>o</sup>C for 10 min, and 40 cycles of 95 <sup>o</sup>C for 15 sec
and 60 <sup>o</sup>C for 1 min. Consult the manufacturer&rsquo;s support
document for operation of the qPCR machine.</p><p>5.3.5) Calculate a standard curve using data from the triplicate
standard dilution series. Compare amplification data of the cDNA sample
to the standard curve to determine the copy number. Consult the
manufacturer&rsquo;s support document for data processing.  </p><p><strong>5.4)</strong> **Determine viral exponential growth phase  </p><p>**</p><p>5.4.1) Plot viral growth kinetics with the sampling day along the X-axis
and the cDNA copy number along the Y-axis and identify the viral
exponential growth phase, i.e., when viral cDNA copy numbers increase in
an exponential progression.</p><p>5.4.2) Use the GRC web tool
(<a href="http://indra.mullins.microbiol.washington.edu/grc/">http://indra.mullins.microbiol.washington.edu/grc/</a>) to calculate
viral growth rate (<em>g</em>). In this application, the GRC tool accepts cDNA
copy numbers from at least two time points as input, and outputs the
viral growth rate (<em>g</em>). Use only time point data within the exponential
growth phase (see step 5.4.1 above) to obtain accurate growth rates. For
a detailed description of the mathematical model used in the GRC web
tool, see<sup>20</sup>.  </p><p><strong>6)</strong> **Growth Competition Assay  </p><p>**</p><p>6.1) Seed 3 x 10<sup>5</sup> PHA-stimulated PBMCs (or 1 x 10<sup>5</sup>
CEMx174 cells<em>)</em> in 500 Âµl total volume per well in a 48 well
flat-bottomed plate.*  </p><p>*</p><p>6.2) Keep plate in 37 <sup>o</sup>C in a 5% CO<sub>2</sub> atmosphere
until inoculation.  </p><p>6.3) For each virus, prepare 3 ml of inoculum containing 6,000 IU.  </p><p>6.4) Transfer 1.5 ml of each viral inoculum to a sterile tube to create
the dual infection inoculum. Add 500 Âµl of the dual inoculum (1,500 IU)
to 3 x 10<sup>5</sup> cells in a 48-well plate. The final culture volume
is 1 ml/well. Aliquot 200 Âµl of the inoculum to two 96-well plates for
RNA isolation; save one plate as a back up.  </p><p>6.5) Incubate inoculated cells at 37 <sup>o</sup>C with a 5%
CO<sub>2</sub> atmosphere for 16-24 hr.</p><p>6.6) Wash cultures 16-24 h after inoculation.</p><p>6.6.1) Remove and discard 750 Âµl of culture supernatant.  </p><p>6.6.2) Add 750 Âµl of fresh cIMDM. Wrap plates in plastic wrap and spin
for 10 minutes at 300 x g. Remove and discard 750 Âµl supernatant.</p><p>6.6.3) Add 750 Âµl of fresh cIMDM. Incubate at 37 <sup>o</sup>C with a
5% CO<sub>2</sub> atmosphere (day 1)<strong>.</strong></p><p>6.7) Select sampling times to include at least 3 time points within the
exponential growth phase observed in step 5.4.1.  </p><p>6.7.1) For each sampling, follow step 5.1.7.  </p><p>6.8) Perform cDNA synthesis as described in section 5.2.  </p><p>6.9) Determine the viral variant ratio using qPCR.</p><p>6.9.1) Prepare a standard serial dilution series in triplicate, diluting
10-fold in each step from 3 x 10<sup>6</sup> copies/Âµl to 30 copies/Âµl
of pNL4-3VifA.</p><p>6.9.2) Set up a 96-well qPCR reaction plate. Ensure that each plate
contains at least one negative control, the standard dilution series in
triplicate, and duplicates of each cDNA sample.</p><p>6.9.3) For each qPCR reaction, use 12.5 Âµl of qPCR Master Mix, 0.2 ÂµM
probe, 0.8 ÂµM each of the forward and reverse primers and 1 Âµl of cDNA
or the standard dilution series or water/buffer (for the negative
control wells). Add water to a final volume of 25 Âµl. The qPCR probe is
light sensitive, keep it in closed container.</p><p>6.9.3.1) Use the VifA primer-probe to detect signals in the negative
controls and the standard dilution series and with one duplicate of the
cDNA sample. Use the VifB primer-probe with the other duplicate of the
cDNA sample.  </p><p>6.9.4) Set PCR cycling parameters to 50 <sup>o</sup>C for 2 min, then 95
<sup>o</sup>C for 10 min, and then 40 cycles of 95 <sup>o</sup>C for 15
sec and 60 <sup>o</sup>C for 1 min. Consult the manufacturer&rsquo;s support
document for operation of the qPCR machine.</p><p>6.9.5) Calculate the standard curve using amplification data from the
standard dilution series. Compare amplification data of the cDNA samples
to the standard curve to determine copy number. Consult the
manufacturer&rsquo;s support document for data processing.</p><p>6.9.6) Use the GRC web tool
(<a href="http://indra.mullins.microbiol.washington.edu/grc/">http://indra.mullins.microbiol.washington.edu/grc/</a>) to calculate
relative viral fitness (<em>d</em>). The GRC tool accepts cDNA copy numbers or
chromatogram peak heights from at least two time points as the input,
and outputs the net growth rate difference (<em>d</em>) between the two
viruses. While the tool can calculate the net growth rate from two time
point data, it is strongly recommended to input data from three or more
time points. Use only data obtained from time points within the
exponential growth phase (see step 5.4) to obtain accurate growth rates.
For a detailed description of the mathematical model used in the GRC web
tool, see<sup>20</sup>.</p><p>6.10) Determine viral ratios using chromatogram peak-heights</p><p>6.10.1) PCR amplify HIV-1 <em>vif</em> fragments containing the VifAB sequence
tag using VifFwd (5â€²-GAAAGAGACTGGCATTTGGGTCAGGG-3â€²; HXB2 positions
5266-5291) and VifRev primers (5â€²-GTCTTCTGGGGCTTGTTCCATCTGTCC-3â€²;
HXB2 positions 5579-5553).</p><p>6.10.1.1) For each PCR reaction, use 1 Âµl of cDNA, 1X NH<sub>4</sub>
buffer, 1.5 mM MgCl<sub>2</sub>, 0.2 mM dNTP, 2.5 U of Taq Polymerase,
and 0.45 ÂµM of each primer. Add water to a final volume of 50 Âµl.  </p><p>6.10.1.2) Set PCR cycling parameters to 3 cycles at 94 <sup>o</sup>C for
1 min, 55 <sup>o</sup>C for 1 min, and 70 <sup>o</sup>C for 1 min,
followed by 34 cycles at 94 <sup>o</sup>C for 15 sec, 58 <sup>o</sup>C
for 30 sec, and 70 <sup>o</sup>C for 1 min, and then hold at 4
<sup>o</sup>C.  </p><p>6.10.2) Purify PCR products using the QIAquick PCR purification kit
according to the manufacturer&rsquo;s protocol.</p><p>6.10.3) Submit purified PCR products to a DNA sequencing service
provider for Sanger sequencing.</p><p>6.10.4) Check the average read quality score, which should be provided
by the sequencing service. If the average base call accuracy is less
than 85%, redo step 6.10.1 to 6.10.3</p><p>6.10.5) Use the ChromatQuant web tool
(<a href="http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi">http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi</a>)
to calculate viral ratio at each time point. The tool requires the
sequence trace file (*.ab1) and the sequence 5&#39; to the nucleotide site
of interest. The tool measures the peak intensity at the specified site.
The ratio of the peak intensity corresponds to the ration of the two
viruses <strong>(Figure 4B).</strong></p><p>6.10.6) Use the GRC web tool
(<a href="http://indra.mullins.microbiol.washington.edu/grc/">http://indra.mullins.microbiol.washington.edu/grc/</a>) and the recorded
peak intensities as the input to calculate viral relative fitness (<em>d</em>).
See step 6.10.6.<sup>20</sup></p>

]]>
        </content>
    </entry>
    
    <entry>
        <title>14C Acetic Acid Labeling</title>
        <link href="https://viroverse.washington.edu/protocols/other/2112-14C-Acetic-Acid-Labeling" rel="alternate" type="text/html" />
        <published>2010-04-01T16:41:56-07:00</published>
        <updated>2011-06-03T15:41:48+00:00</updated>
        <id>urn:uuid:aa8e9d32-a6b6-5933-b977-b84a30d7af4f</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p>9 May 2003</p><p><strong>Reagents:</strong></p>
<ul>
<li><p><sup>14</sup>C Acetic acid sodium salt, Amersham CFA.13, 0.2
ÂµCi/Âµl</p></li>
<li><p>1x PBS</p></li>
<li><p>H<sub>2</sub>O</p></li>
<li><p>Chloroform, Methanol, Hexane, Isopropanol, 4 L, Stores</p></li>
<li><p>Long glass tubes and glass pipettes</p></li>
<li><p>Micropipette, VWR 53432-783</p></li>
<li><p>TLC Silica gel 60 (20 x 20 cm), VWR EM-11845-7, 25/$231.53</p></li>
<li><p>Carrier lipid stocks; UC (unstearified cholesterol) 1 mg/ml, CE
(cholesterol ester) 0.5 mg/ml, TG (triglyceride) 1 mg/ml.</p></li>
<li><p>Neutrolipid solvent (N.L.); 108 ml hexethane, 1.2 ml HAc (glacial),
30 ml Diethyl Ether (anhydrous); available at Stores</p></li>
<li><p>Iodine Crystals</p></li>
<li><p>Scintillation Fluid (Ecolume) and vials (Wheaton #986644)</p></li>
</ul>
<p><strong>Protocol:</strong></p>
<ol>
<li><p> Set up cultures at 5 x 10<sup>5</sup> cells/ml in 2 ml with
<sup>14</sup>C acetate (10 Âµl at 0.2 ÂµCi/Âµl &ndash; final 1 ÂµCi/Âµl).</p></li>
<li><p> Grow 1 to 2 hours.</p></li>
<li><p> Wash with 1x PBS (important to remove FBS).</p></li>
<li><p> Store cell pellet at -20Â°C until ready for further processing.</p></li>
<li><p> Add 1 ml Hexane:Isopropanol 3:1 v/v (to extract lipids from pellet).</p></li>
<li><p> Vortex.</p></li>
<li><p> Incubate 30 minutes at RT.</p></li>
<li><p> Transfer supernatant to new glass tube careful not to touch the
pellet.</p></li>
<li><p> Wash pellet with 1 ml Hexane:Isopropanol. Transfer supernatant to
same glass tube.</p></li>
<li><p>Evaporate to dryness under air stream in 40Â°C heat block.</p></li>
<li><p>Add 4 ml Folch (chloroform:methanol 2:1 v/v).</p></li>
<li><p>Add 1 ml H<sub>2</sub>O.</p></li>
<li><p>Add 20 Âµg complete carrier lipid to each sample.</p></li>
<li><p>Vortex.</p></li>
<li><p>Incubate 20-30 minutes at RT.</p></li>
<li><p>Vortex.</p></li>
<li><p>Spin for 10 minutes at 2000 rpm.</p></li>
<li><p>Aspirate top aqueous phase, keep organic phase.</p></li>
<li><p>Add 1 ml H<sub>2</sub>O.</p></li>
<li><p>Vortex.</p></li>
<li><p>Spin for 10 minutes at 2000 rpm.</p></li>
<li><p>Aspirate top aqueous phase, keep organic phase.</p></li>
<li><p>Evaporate to dryness under air stream in 40Â°C heat block.</p></li>
<li><p>Rinse sides with chloroform.</p></li>
<li><p>Evaporate to dryness under air stream in 40Â°C heat block.</p></li>
<li><p>Resuspend in 110 Âµl chloroform.</p></li>
<li><p>Spot at ~1.5 cm from bottom of gel (above tank solvent).</p>
<ol>
<li> Spot carrier alone for a reference band.</li>
</ol></li>
</ol>

<!-- end list -->

<ol>
<li><p>Place gel in tank with solvent and run.</p>
<ol>
<li><p> Run until gel is completely saturated ~20 min.</p></li>
<li><p> Dry gel on 40Â°C heat block.</p></li>
</ol></li>
</ol>

<!-- end list -->

<ol>
<li><p>Place gel in tank of fresh iodine crystals until all bands are
clearly visible.</p></li>
<li><p>Mark bands of interest with pencil.</p></li>
<li><p>Dry gel until iodine stained bands are clearly not visible.</p></li>
<li><p>Cut marked bands into scintillation vials and add 4.5 ml
scintillation fluid.</p></li>
</ol>
<p>Reference: Oram Lab, Medicine, Metabolism Endocrinology, University of
Washington</p>

]]>
        </content>
    </entry>
    
    <entry>
        <title>14C Mevalonic Acid Labeling</title>
        <link href="https://viroverse.washington.edu/protocols/other/434-14C-Mevalonic-Acid-Labeling" rel="alternate" type="text/html" />
        <published>2010-04-01T16:41:11-07:00</published>
        <updated>2011-06-03T15:44:56+00:00</updated>
        <id>urn:uuid:b8f866c6-c41c-560e-907d-3a8d35ee159d</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p>8 March 2002</p><p><strong>Reagents:</strong></p>
<ul>
<li><p><sup>14</sup>C mevalonic acid DBED salt, NEC166, 0.1 ÂµCi/Âµl</p></li>
<li><p>1x PBS</p></li>
<li><p>H<sub>2</sub>O</p></li>
<li><p>Glass tubes, 16 ml, VWR 60828-387, 72/$134.02</p></li>
<li><p>Glass tubes, 50 ml, VWR 60828-423, 36/$112.25</p></li>
<li><p>Chloroform, 4 L, Stores</p></li>
<li><p>Methanol, 4 L, Stores</p></li>
<li><p>N<sub>2</sub> gas stream</p></li>
<li><p>Petroleum ether (35-60Â°C), 1 L, Stores 0014-285, $8.99</p></li>
<li><p>Na<sub>2</sub>SO<sub>4</sub> (anhydrous), 3 kg, Stores 0004-410,
$28.09</p></li>
<li><p>Glass pasteur pipette</p></li>
<li><p>Glass wool</p></li>
<li><p>Toluene (purified), 4 L, Stores 0015-070, $17.45</p></li>
<li><p>Ethyl ether (anhydrous), 1 L, Stores 0012-625, $17.14</p></li>
<li><p>TLC silica gel 60 (20 x 20 cm), VWR EM-11845-7, 25/$231.53</p></li>
<li><p>Iodine (crystal), VWR MK098402, 125 g/$98.40</p></li>
</ul>
<p><strong>Protocol:</strong></p>
<ol>
<li><p> Set up culture at 10<sup>6</sup> cells/ml in 100ml with
<sup>14</sup>C mevalonate<br>
(50 Âµl at 0.1 ÂµCi/Âµl &ndash; final 0.05 ÂµCi/ml).</p></li>
<li><p> Grow 0 to 48 hours.</p></li>
<li><p> Wash with 1x PBS (important to remove FBS).</p></li>
<li><p> Resuspend in 1ml H<sub>2</sub>O. Use glass tubes from here on.</p></li>
<li><p> Add to 10ml chloroform:methanol (2:1 v/v).</p></li>
<li><p> Stir at RT for 3 hours.</p></li>
<li><p> Evaporate under N<sub>2</sub> gas stream for ~1 hour until solution
turns cloudy.</p></li>
<li><p> Extract 2x with 10 ml petroleum ether at 40-60Â°C.</p></li>
<li><p> Lower fraction ~500 Âµl, transfer upper fraction (x2) to 50 ml
tube.</p></li>
<li><p>Dry with anhydrous Na<sub>2</sub>SO<sub>4</sub>.</p></li>
<li><p>Filter through pasteur pipette with glass wool.</p></li>
<li><p>Evaporate to dryness under N<sub>2</sub>.</p></li>
<li><p>Store at -20Â°C until use.</p></li>
<li><p>Place 100 ml solvent in tank (toluene:diethylether 9:1 v/v).</p></li>
<li><p>Resuspend samples in 100 Âµl petroleum ether (vaporizes rapidly).</p></li>
<li><p>Spot at ~1.5 cm above bottom of gel.</p></li>
<li><p>Place gel in tank and run about 1.5 hrs or until solvent front
reaches about one inch from the top of the plate.</p></li>
<li><p>Remove from tank and dry overnight to prevent <sup>14</sup>C
contamination of phosphor-screen.</p></li>
<li><p>Cover in plastic wrap and expose on a phosphor-screen to visualize
<sup>14</sup>C-labeled compounds.</p></li>
<li><p>To visualize markers, sprinkle crystals of iodine on the bottom of a
sealable glass container.</p></li>
<li><p>Place plates in container and seal lid.</p></li>
<li><p>Wait 20-30 minutes for entire plate to be exposed.</p></li>
<li><p>Circle visualized spots as staining will quickly fade.</p></li>
<li><p>Calculate R<sub>f</sub> value by dividing the distance traveled of
substance by the distance traveled of solvent front.</p></li>
</ol>


]]>
        </content>
    </entry>
    
    <entry>
        <title>SDS-PAGE Protein Gels</title>
        <link href="https://viroverse.washington.edu/protocols/molecular_biology/466-SDS-PAGE-Protein-Gels" rel="alternate" type="text/html" />
        <published>2010-04-01T16:39:59-07:00</published>
        <updated>2011-06-03T15:43:47+00:00</updated>
        <id>urn:uuid:6d252150-0d19-5568-9732-8f0858f0eabc</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p><strong><span class="underline">Reagents</span></strong></p><p>4X Trisï¿½Cl/SDS pH 8.8 Buffer</p>
<ul>
<li><p>91 g Tris base</p></li>
<li><p>300 mL H<sub>2</sub>O</p></li>
<li><p>Adjust to pH 8.8 with HCl</p></li>
<li><p>Add H<sub>2</sub>O to 500 mL total volume</p></li>
<li><p>2 g SDS</p></li>
</ul>
<p>4x Trisï¿½Cl/SDS pH 6.8 Buffer</p>
<ul>
<li>6.05 g Tris base</li>
</ul>
<p>0.4 g SDS</p>
<ul>
<li><p>40 mL H<sub>2</sub>O</p></li>
<li><p>Adjust to pH 6.8 with HCl</p></li>
<li><p>Add H<sub>2</sub>O to 100 mL total volume</p></li>
</ul>
<p>30% acrylamide/0.8% bisacrylamide</p>
<ul>
<li><p><strong>Store at 4Â°C in the dark</strong></p></li>
<li><p>30.0 g acrylamide</p></li>
<li><p>0.8 g N, N&#39;-methylenebisacrylamide</p></li>
<li><p>Add H<sub>2</sub>O to 100 mL total volume</p></li>
</ul>
<p>5x SDS Electrophoresis Buffer</p>
<ul>
<li><p>15.1 g Tris base</p></li>
<li><p>72.0 g glycine</p></li>
<li><p>5.0 g SDS</p></li>
<li><p>Add H<sub>2</sub>O to 1000 mL total volume</p></li>
</ul>
<p>Isopropanol Fixing Solution</p>
<ul>
<li><p>25% (vol/vol) isopropanol</p></li>
<li><p>10% (vol/vol) acetic acid</p></li>
</ul>
<p>Rapid Coomassie Staining Solution</p>
<ul>
<li><p>10% (vol/vol) acetic acid</p></li>
<li><p>0.006% (wt/vol) Coomassie G-250</p></li>
</ul>
<p>Destaining Wash Solution</p>
<ul>
<li>10% (vol/vol) acetic acid</li>
</ul>
<p><strong><span class="underline">Protocol:</span></strong></p>
<ol>
<li><p> Make fresh 10% Ammonium Persulfate.</p></li>
<li><p> Assemble the gel casting apparatus, making sure that the sandwich of
glass plates and spacers will make a good seal.</p></li>
<li><p> Prepare the Separating Gel solution according to the acrylamide
concentration needed.
Vortex.</p></li>
</ol>

<h2>Separating Gel</h2>

<table>
<thead>
<tr>
<th></th>
<th></th>
<th></th>
<th></th>
<th></th>
<th></th>
<th></th>
<th></th>
<th></th>
<th></th>
</tr>
</thead>

<tbody>
<tr>
<td>Final acrylamide conc</td>
<td>5%</td>
<td>6%</td>
<td>7%</td>
<td>8%</td>
<td>9%</td>
<td>10%</td>
<td>12%</td>
<td>13%</td>
<td>15%</td>
</tr>
<tr>
<td>30% acryl/0.8% bisacryl</td>
<td>2.5 ml</td>
<td>3.0</td>
<td>3.5</td>
<td>4.0</td>
<td>4.5</td>
<td>5.0</td>
<td>6.0</td>
<td>6.5</td>
<td>7.5</td>
</tr>
<tr>
<td>H<sub>2</sub>O</td>
<td>8.8 ml</td>
<td>8.3</td>
<td>7.8</td>
<td>7.3</td>
<td>6.8</td>
<td>6.3</td>
<td>5.3</td>
<td>4.8</td>
<td>3.8</td>
</tr>
<tr>
<td>4x Trisï¿½Cl/SDS pH 8.8</td>
<td>3.7 ml</td>
<td>3.7</td>
<td>3.7</td>
<td>3.7</td>
<td>3.7</td>
<td>3.7</td>
<td>3.7</td>
<td>3.7</td>
<td>3.7</td>
</tr>
<tr>
<td>10% ammonium persulfate</td>
<td>200 Âµl</td>
<td>200</td>
<td>200</td>
<td>200</td>
<td>200</td>
<td>200</td>
<td>200</td>
<td>200</td>
<td>200</td>
</tr>
<tr>
<td>TEMED</td>
<td>10 Âµl</td>
<td>10</td>
<td>10</td>
<td>10</td>
<td>10</td>
<td>10</td>
<td>10</td>
<td>10</td>
<td>10</td>
</tr>
</tbody>
</table>

<ol>
<li><p> Load the apparatus with 4.5 mL of the Separating Gel solution.</p></li>
<li><p> Top with ~1 mL of Isoamyl alcohol to isolate the polymerization
from oxygen.</p></li>
<li><p> After polymerization, pour off the Isoamyl alcohol, and rinse with
distilled water.</p></li>
<li><p> Remove any water droplets from the inside of the casting apparatus
with Whatman paper or a paper towel. Insert the comb for the
stacking gel.</p></li>
<li><p> Prepare the Stacking Gel solution. Vortex.</p></li>
</ol>
<p><strong><span class="underline">Stacking Gel</span></strong> (5% acrylamide)</p>
<table>
<thead>
<tr>
<th></th>
<th></th>
</tr>
</thead>

<tbody>
<tr>
<td>H<sub>2</sub>O</td>
<td>3.0 mL</td>
</tr>
<tr>
<td>4x Trisï¿½Cl/SDS pH 6.8</td>
<td>1.3 mL</td>
</tr>
<tr>
<td>30% acrylamide/0.8% bisacrylamide</td>
<td>0.9 mL</td>
</tr>
<tr>
<td>10% ammonium persulfate</td>
<td>80 ÂµL</td>
</tr>
<tr>
<td>TEMED</td>
<td>5 ÂµL</td>
</tr>
</tbody>
</table>

<ol>
<li><p> Load the Stacking Gel solution, taking care not to introduce air
bubbles around the comb (some bubbles can be removed by pipetting up
and down).</p></li>
<li><p>Allow the Stacking Gel to polymerize completely (~45 minutes)
before removing comb.</p></li>
<li><p>Prepare the samples:</p>
<ol>
<li><p> Dilute the protein sample 1:1 with 2x SDS Sample Buffer.</p></li>
<li><p> Heat the samples and the molecular weight standards for 5
minutes at 100Â°C.</p></li>
</ol></li>
<li><p>Remove the glass and gel sandwich from the casting apparatus.</p></li>
<li><p>Clip the sandwich to the electrophoresis apparatus. Carefully remove
the comb from the gel and fill the top of the apparatus with 1x SDS
Electrophoresis Buffer.</p></li>
<li><p>Using a 20-gauge needle, flush the wells with buffer.</p></li>
<li><p>Carefully load the samples into the bottom of the wells using a
flat-tipped pipette tip.</p></li>
<li><p>Fill the bottom of the electrophoresis apparatus with 1x SDS
Electrophoresis Buffer and connect the apparatus to the power
supply.</p></li>
<li><p>Run the gel at 10 mA until the dye enters the separating gel. Then
increase the current to 15 mA.</p></li>
<li><p>When the dye reaches the bottom of the separating gel, turn off the
power supply, and remove the gel sandwich.</p></li>
<li><p>Carefully open the sandwich by using one of the spacers to pry the
plates apart.</p></li>
<li><p>Gently cut away the stacking gel and place the separating gel in a
small plastic container for staining.</p></li>
<li><p>Cover the gel with fixing solution and shake gently for 15 minutes.</p></li>
<li><p>Pour off the fixer and cover the gel with staining solution. Shake
gently for at least 2 hours.</p></li>
<li><p>Pour off the staining solution and cover the gel with the wash
solution. Destain for at least 2 hours. (It is usually necessary to
change the wash solution at least once)</p></li>
<li><p>The gel can be stored in water or dried down between sheets of
cellulose on a drying frame.</p></li>
</ol>
<p><em>Angela McKay, 22 December 1999</em></p>

]]>
        </content>
    </entry>
    
    <entry>
        <title>Plate Submitting Protocol</title>
        <link href="https://viroverse.washington.edu/protocols/molecular_biology/1345-Plate-Submitting-Protocol" rel="alternate" type="text/html" />
        <published>2010-04-01T16:39:23-07:00</published>
        <updated>2011-06-03T15:45:36+00:00</updated>
        <id>urn:uuid:4df9da82-596c-52c7-8569-bbecb97f7f13</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p>From <a href="mailto:lekha@u.washington.edu">Lehka Devarayalu</a> for the <a href="http://depts.washington.edu/biowww/dna/">UW
Biochem Sequencing Facility</a>:  </p>
<ol>
<li><p> ONE ORDER = ONE PLATE = 96 TOTAL SAMPLES &hellip;.. (there should be no
empty wells).  </p></li>
<li><p> Samples are to be loaded in vertical columns going from A-1 to H-1,
A-2 to H-2, A-3 to H-3 and so on till A-12 to H-12 .  </p></li>
<li><p> We must receive the full 12 ï¿½l volume of &lsquo;DNA + primer + dI water&rsquo;
cocktail.  </p></li>
<li><p> Since the sample volume is small, the plates must be &lsquo;V&rsquo; bottomed,
200 ï¿½l capacity (not 500 ï¿½l), stable on bench-top, and
well-sealed to withstand cross contamination between wells in
transportation from Rosen to Hitchcock.  </p></li>
<li><p> The plates must be CLEARLY LABELLED WITH THE CORRESPONDING ORDER
NUMBER. ORDER NUMBERS ARE UNIQUE NUMBERS GENERATED BY THE SOFTWARE.
If instead of order numbers, plates bear #1, #2, OR &lsquo;forward,&rsquo;
&lsquo;reverse,&rsquo; etc., THEY WILL NOT BE PROCESSED.  </p></li>
<li><p> Being &lsquo;high throughput&rsquo; and fast, we do not want to be tethered to
the client by phone/by e-mail following each sample drop-off. Please
take the time in your lab to MATCH THE PAPER-WORK WITH SAMPLES. If
you are &ldquo;too rushed&rdquo; &hellip;. STOP &hellip;. keep the samples with you!  </p></li>
<li><p> When new users from your group want to use our facility&hellip; please,
work with them a few times until they are comfortable with these
guidelines.</p></li>
</ol>
<p><em>Dec 7, 2004</em></p>

]]>
        </content>
    </entry>
    
    <entry>
        <title>Sequence Analysis for Research Genetics Clones</title>
        <link href="https://viroverse.washington.edu/protocols/data_analysis/2491-Sequence-Analysis-for-Research-Genetics-Clones" rel="alternate" type="text/html" />
        <published>2010-04-01T16:37:30-07:00</published>
        <updated>2011-06-03T15:49:48+00:00</updated>
        <id>urn:uuid:d4418ad5-b35e-5bfe-947e-3f37f31af963</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p>Fetch files from CFAR DSF ftp-site</p><p>Start SEQUENCHER</p><p>Drag sequences to SEQUENCHER window</p><p>Open files by double clicking</p><p>Only use files with good signal</p><p>Find restriction site of vector (eg. EcoRI GAATTC) with FIND option</p><p>Crop vector sequence</p><p>Open chromatogram</p><p>Find where good sequence ends or poly A tail starts</p><p>Crop rest of sequence</p><p>Export sequence as Pearson text</p><p>One file:</p>
<ul>
<li><p>copy sequence into window at NCBI webpage</p></li>
<li><p>do basic blastn nr search</p></li>
</ul>
<p>Multiple files:</p>
<ul>
<li><p>start SEARCH LAUNCHER by dropping sequence files onto the camel
symbol</p></li>
<li><p>type DNA</p></li>
<li><p>type 10 (BLASTN NR) or 12 (dbEST)</p></li>
<li><p>results are returned into the SEARCH LAUNCHER directory</p></li>
</ul>


]]>
        </content>
    </entry>
    
    <entry>
        <title>Big Dye Terminator Sequencing</title>
        <link href="https://viroverse.washington.edu/protocols/molecular_biology/1975-Big-Dye-Terminator-Sequencing" rel="alternate" type="text/html" />
        <published>2010-04-01T16:36:48-07:00</published>
        <updated>2011-06-03T15:49:36+00:00</updated>
        <id>urn:uuid:12d7208a-564b-5528-aed8-a5d2cbbed62a</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p><span class="underline"><strong>Reagents</strong>:</span></p>
<ul>
<li><p>Big Dye Terminator kit from Perkin Elmer</p></li>
<li><p>Gene specific primers (need 3.2 pmol/reaction)</p></li>
<li><p>Sample DNA:</p>
<ul>
<li>200-300 ng for dsDNA</li>
<li>75-100 ng for ssDNA</li>
<li>90-150 ng for PCR products</li>
</ul></li>
<li><p>ddH<sub>2</sub>O</p></li>
<li><p>Isopropanol</p></li>
<li><p>Mineral Oil</p></li>
</ul>
<p><span class="underline"><strong>Protocol</strong>:</span></p>
<ol>
<li><p> Quantify DNA or PCR product using the Spectrophotometer. The
protocol applies to a full reaction. In case of a half reaction,
divide all volumes in half but DO NOT decrease DNA or primer
amounts.</p></li>
<li><p> Mix sample DNA and specific primers to 12 Âµl total volume.</p></li>
<li><p> Add 8 Âµl Terminator Ready Reaction mix.</p></li>
<li><p> Mix well and spin briefly (do not vortex).</p></li>
<li><p> If thermal cycler does not have a heated lid, overlay the reaction
mix with 40 Âµl mineral oil.</p></li>
<li><p> Put the tubes in thermal cycler and set volume to 20 Âµl.</p></li>
<li><p> Program cycle below and repeat for 25 cycles:</p>
<ol>
<li><p> In a GeneAmp 9600/9700 or 2400</p>
<ol>
<li><p> 96Â°C for 10 seconds</p></li>
<li><p> 50Â°C for 15 seconds</p></li>
<li><p> 60Â°C for 4 minutes</p></li>
<li><p> 4Â°C soak until needed</p></li>
</ol></li>
<li><p> In a Thermal Cycler (TC1) or in a DNA Thermal Cycler 480</p>
<ol>
<li><p> 96Â°C for 30 seconds</p></li>
<li><p> 50Â°C for 15 seconds</p></li>
<li><p> 60Â°C for 4 minutes</p></li>
<li><p> 4Â°C soak until needed</p></li>
</ol></li>
</ol></li>
<li><p> Spin for 1 minute to remove condensation.</p></li>
<li><p> Add 20 Âµl ddH<sub>2</sub>O and 60 Âµl 100% Isopropanol, for 100 Âµl
final volume. (Half reactions: add 30Âµl ddH<sub>2</sub>O instead of
20 Âµl.)</p></li>
<li><p>Precipitate at room temperature for 20-30 minutes.</p>
<ol>
<li><p> <em>Strip well or 96-well plates:</em></p>
<ol>
<li><p> Spin for 30 minutes at 3000x g</p></li>
<li><p> Remove from centrifuge and turn upside down on paper towel</p></li>
<li><p> Spin for 1 minute at 700x g to remove residual Isopropanol</p></li>
<li><p> Remaining Isopropanol: dry in 37Â°C oven for 2 minutes (no
longer).</p></li>
</ol></li>
<li><p> <em>Individual tubes:</em></p>
<ol>
<li><p> Spin for 20 minutes at 14000 rpm</p></li>
<li><p> Remove the Isopropanol after spinning</p></li>
<li><p> Add 250 Âµl 75% Isopropanol, vortex briefly</p></li>
<li><p> Spin for 5 minutes at 14000 rpm</p></li>
<li><p> Remove Isopropanol.</p></li>
<li><p> Dry in heating block.</p></li>
</ol></li>
</ol></li>
<li><p>Fill out sequencing data form.</p></li>
<li><p>Put the samples in the -20Â°C freezer by the DNA Sequencing
facility.</p></li>
</ol>


]]>
        </content>
    </entry>
    
    <entry>
        <title>Isolation of Chromosomal DNA from Mammalian Cells</title>
        <link href="https://viroverse.washington.edu/protocols/molecular_biology/1270-Isolation-of-Chromosomal-DNA-from-Mammalian-Cells" rel="alternate" type="text/html" />
        <published>2010-04-01T16:33:07-07:00</published>
        <updated>2011-06-03T15:50:29+00:00</updated>
        <id>urn:uuid:d02012bb-7133-50d4-a157-421fbd4b9ea3</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p><span class="underline"><strong>A. Reagents:</strong></span></p><p>Lysis buffer:</p>
<blockquote>
<p>0.45% Tween, 0.45% NP40, 2.5 mM MgCl<sub>2</sub>, 50 mM KCl, 10 mM
Tris-Cl pH8.3, 100 Âµg/Âµl, Proteinase K</p></blockquote>

<table>
<thead>
<tr>
<th></th>
<th></th>
</tr>
</thead>

<tbody>
<tr>
<td>Tween20</td>
<td>225 Âµl</td>
</tr>
<tr>
<td>NP40</td>
<td>225 Âµl</td>
</tr>
<tr>
<td>1 M MgCl<sub>2</sub></td>
<td>125 Âµl</td>
</tr>
<tr>
<td>1 M KCl</td>
<td>2.5ml</td>
</tr>
<tr>
<td>1 M Tris-Cl pH 8.3</td>
<td>0.5ml</td>
</tr>
<tr>
<td>20 Âµg/ml Prot K</td>
<td>250 Âµl<sup>*</sup></td>
</tr>
<tr>
<td>dH<sub>2</sub>O</td>
<td>46.2 ml</td>
</tr>
</tbody>
</table>
<p>* Add Proteinase K just before use, 5 Âµl stock per ml of lysis buffer
used.</p><p><span class="underline"><strong>A. Protocol:</strong></span></p>
<ol>
<li><p> Wash cells with cold PBS.</p></li>
<li><p> Resuspend at 10,000 cells/Âµl in lysis buffer.</p></li>
<li><p> Incubate at 56Â°C for 1 hour.</p></li>
<li><p> Boil for 10 minutes.</p></li>
<li><p> Store lysate at -20Â°C</p></li>
</ol>
<p><span class="underline"><strong>B. Reagents:</strong></span></p><p>L6 buffer:</p>
<blockquote>
<p>0.08 M GuSCN (LifeTechnologies GibcoBRL), 0.08 M Tris-Cl pH 6.4, 0.035
M EDTA, 2% (wt/vol) Triton X-100</p></blockquote>
<p><span class="underline"><strong>B. Protocol<sup>*</sup>:</strong></span></p>
<ol>
<li><p> Wash cells with cold PBS</p></li>
<li><p> Resuspend at 10<sup>6</sup> cells/ml in L6 buffer.</p></li>
<li><p> Add an equal volume of Isopropanol.</p></li>
<li><p> Spin at 14000 rpm for 30 minutes at 4Â°C.</p></li>
<li><p> Discard supernatant.</p></li>
<li><p> Wash pellet twice with 75% Ethanol.</p></li>
<li><p> Airdry pellet.</p></li>
<li><p> Resuspend pellet in 100 Âµl dH<sub>2</sub>O. Store at -20 Â°C.</p></li>
</ol>
<p><em>* Adapted from Boom et al. J.Clin.Microbiol. 1991, 28:495-503.</em></p>

]]>
        </content>
    </entry>
    
    <entry>
        <title>TaqMan Assays on Demand Preparation and Real Time PCR</title>
        <link href="https://viroverse.washington.edu/protocols/molecular_biology/2299-TaqMan-Assays-on-Demand-Preparation-and-Real-Time-PCR" rel="alternate" type="text/html" />
        <published>2010-04-01T16:32:34-07:00</published>
        <updated>2011-06-03T15:50:57+00:00</updated>
        <id>urn:uuid:0f13cb76-56e3-56f0-a1cc-6c02e047b853</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p><span class="underline"><strong>Reagent/Supplies</strong>:</span></p>
<ul>
<li><p>DNA-<em>free</em><sup>TM</sup>, 50 reactions, <a href="http://www.ambion.com/catalog/CatNum.php?1906">Ambion
#1906</a>, $65</p></li>
<li><p>Oligo dT, 24mer (prep&rsquo;d by Sherry)</p></li>
<li><p>dNTP Set, 4 x 25 Âµmol 100 mM, <a href="http://www.bioline.com/n_catdetail.asp?user_prodname=dNTP+Set">Bioline
#BIO-39025</a>,
$125</p></li>
<li><p>RNase Inhibitor, 2,000 U, <a href="http://www.roche-applied-science.com/proddata/intnl/3_6_6_1_2_2.htm">Roche Applied Science
#3335399</a></p></li>
<li><p>SuperScript III Reverse Transcriptase, 2,000 U, <a href="http://www.invitrogen.com/content.cfm?pageid=4442">Invitrogen
#18080-093</a>,
$59.40</p></li>
<li><p>Ribonuclease H, 30 U, <a href="https://catalog.invitrogen.com/index.cfm?fuseaction=viewCatalog.viewProductDetails&amp;productDescription=139">Invitrogen
#18021-014</a>,
$99</p></li>
<li><p>TaqMan<sup>ï¿½</sup> beta-actin Detection Reagents, 100 reactions,
<a href="http://www.appliedbiosystems.com/catalog/myab/StoreCatalog/products/ProductList.jsp?hierarchyID=101&amp;category1st=19360&amp;category2nd=112345&amp;category3rd=112222">ABI
#401846</a>,
$150</p></li>
<li><p>TaqMan<sup>ï¿½</sup> Universal PCR Master Mix, No
AmpErase<sup>ï¿½</sup> UNG, 200 reactions, <a href="http://www.appliedbiosystems.com/catalog/myab/StoreCatalog/products/ProductList.jsp?hierarchyID=101&amp;category1st=19360&amp;category2nd=112347&amp;category3rd=112243">ABI
#4324018</a>,
$355</p></li>
</ul>
<p><span class="underline"><strong>Protocol</strong>:</span></p><p><em>DNA digestion</em>:</p>
<ol>
<li><p> Keep extracted RNA on ice or thaw total RNA on ice (10 pg- 5 Âµg
required total RNA).</p></li>
<li><p> Thaw DNA-<em>free</em> reagents on ice.</p></li>
<li><p> Add 0.1v 10 x DNase buffer and 1 Âµl DNase I to appropriate amount
of total RNA and mix by flicking.</p></li>
<li><p> Incubate 20 minutes at 37Â°C.</p></li>
<li><p> Mix DNase Inactivation reagent well. If reagent is difficult to mix,
add 1v H<sub>2</sub>O/0.1 mM EDTA.</p></li>
<li><p> Add 0.1v DNase Inactivation reagent.</p></li>
<li><p> Incubate 2 minutes, flicking intermittently.</p></li>
<li><p> Spin 1 minute at 10,000 x g to pellet DNase Inactivation reagent.</p></li>
<li><p> Remove supernatant and use, or store at -70Â°C.</p></li>
</ol>
<p><em>cDNA synthesis</em>:</p>
<ol>
<li><p> Keep on ice: oligo DT (20 mM), dNTP (20 mM), 5x SST buffer, DTT,
SuperScript III, RNase Out, and DNA digested RNA.</p></li>
<li><p> To 4 Âµl DNA digested RNA, add 8 Âµl of the following mastermix for
1 reaction(s) (enter # of reaction):</p>
<ul>
<li>1 Âµl oligo DT (20 ÂµM)</li>
<li>0.5 Âµl dNTP (20 mM)</li>
<li>6.5 Âµl ddH<sub>2</sub>O</li>
</ul></li>
<li><p> Incubate 5 minutes at 65Â°C.</p></li>
<li><p> Cool on ice.</p></li>
<li><p> While cooling, make the following mastermix for 1 reaction(s) (enter
# of reaction):</p>
<ul>
<li>4 Âµl 5x 1st strand buffer</li>
<li>2 Âµl 100 mM DTT</li>
<li>1 Âµl RNase OUT (RNase inhibitor)</li>
</ul></li>
<li><p> Add 7 Âµl of mastermix.</p></li>
<li><p> Add 1 Âµl of SSTIII (SuperScript III). Flick and collect.</p></li>
<li><p> Run sample in thermocycler:</p>
<ol>
<li><p> 42Â°C for 50 minutes</p></li>
<li><p> 70Â°C for 15 minutes</p></li>
<li><p> 4Â°C soak until needed</p></li>
</ol></li>
</ol>

<!-- end list -->

<ol>
<li><p> Add 1 Âµl RNase H to remove complimentary strand.</p></li>
<li><p>Incubate 20 minutes at 37Â°C.</p></li>
<li><p>Estimate cDNA yield using a spectrophotometer.</p></li>
<li><p>Dilute to appropriate concentration: 5 Âµl TaqMan template input.</p></li>
</ol>
<p><em>TaqMan</em>:</p>
<ol>
<li><p> Aliquot 5 Âµl sample and/or DNA template to optical tubes. Seal with
Parafilm.</p></li>
<li><p> Prepare Mastermix in PCR setup room. Click to download <a href="http://mullinslab.microbiol.washington.edu/protocols/other/MastermixWizard.xls">Mastermix
Wizard</a></p></li>
<li><p> Add 15 Âµl Mastermix to optical tubes and cap. Keep on ice and
transfer to ABI 7700.</p></li>
<li><p> Flick and spin to collect. Run on ABI 7700.</p></li>
</ol>


]]>
        </content>
    </entry>
    
    <entry>
        <title>TOPO T/A Cloning of PCR Products</title>
        <link href="https://viroverse.washington.edu/protocols/molecular_biology/1019-TOPO-T-A-Cloning-of-PCR-Products" rel="alternate" type="text/html" />
        <published>2010-04-01T16:31:58-07:00</published>
        <updated>2011-06-03T15:10:13+00:00</updated>
        <id>urn:uuid:cb4d56e6-8ce0-5bcd-9c2c-5f6819641d48</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<h1>Addition of 3&#39;A-overhangs post amplification</h1>

<ol>
<li><p> Add 0.7 - 1.0 U of Taq polymerase (Biolase) to PCR product.</p></li>
<li><p> Mix well. Incubate at 72 Â°C for 8-10 minutes. Use immediately.</p></li>
</ol>
<p><strong><span class="underline">Modified Topo T/A cloning protocol</span></strong></p><p><strong>Preparation:</strong></p>
<ol>
<li><p> Spread each Carb. plate with 40 Âµl of 40mg/ml X-gal.</p></li>
<li><p> Pre-warm plates in warm room.</p></li>
</ol>
<p><strong>Ligation:</strong></p>
<ol>
<li><p> Dilute PCR product 1 in 4 with dH<sub>2</sub>O.</p></li>
<li><p> Combine:<br>
Topo T/A vector mix 0.25 Âµl<br>
PCR product dilution 1.00 Âµl<br>
dH<sub>2</sub>0 1.25 Âµl</p></li>
<li><p> Incubate 5 minutes at room temperature, and then put on ice.</p></li>
</ol>
<p><strong>Transformation:</strong></p>
<ol>
<li><p> Top10 cells should be thawed GENTLY and placed on ice; keep
everything cold.</p></li>
<li><p> Combine:<br>
Ligation 1.5 Âµl<br>
0.25ul Î²-ME 1.0 Âµl<br>
Top10 cells 10.0 Âµl</p></li>
<li><p> Stir gently with pipette tip.</p></li>
<li><p> Chill on ice for 15 minutes.</p></li>
<li><p> Heat shock in 42Â°C water bath for 30 seconds.</p></li>
<li><p> Chill on ice for 2 minutes.</p></li>
<li><p> Add 125 Âµl SOC-media and incubate -shaking- at 37Â°C for 1 hr.</p></li>
<li><p> Plate the entire transformation on LB-carb + X-Gal plates.</p></li>
<li><p> Place plates in warm room overnight.</p></li>
<li><p>When cloning a 750 bp product, this procedure consistently gives
100-200 colonies per plate.</p></li>
</ol>


]]>
        </content>
    </entry>
    
    <entry>
        <title>WALKER WHOLE GENOME SUBTYPE C PROTOCOLS</title>
        <link href="https://viroverse.washington.edu/protocols/molecular_biology/743-WALKER-WHOLE-GENOME-SUBTYPE-C-PROTOCOLS" rel="alternate" type="text/html" />
        <published>2010-04-01T16:30:10-07:00</published>
        <updated>2011-06-03T15:52:09+00:00</updated>
        <id>urn:uuid:67ddaccc-2c56-5e2d-a3c6-5227534198ad</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<h5>(last updated 10/05/2004)</h5>

<h1>RNA Extraction (QIAgen Viral RNA Kit) (BL3)</h1>
<p>When working in the BL3, remember to use extreme care. Clean the
workspace with 70% Et-OH before and after use, and make sure that
contaminated tubes and tips are neutralized with Westcodyne.</p>
<ul>
<li>Check the heat block. Heat to 80Â°C, if needed.</li>
<li>Pull the samples from the freezer to thaw.</li>
</ul>
<p>Buffer AVL precipitates at 4Â°C after addition of the Carrier RNA.</p>
<ul>
<li>Remove Buffer AVL from the fridge and place on the 80Â°C heating
block. Vortex after ~2 minutes. Do not heat for more than 5
minutes, and do not heat more than 6 times.</li>
</ul>
<p>Carrier RNA dissolved in buffer AVL is stable for up to 6 months at
4Â°C.</p><p>For each quadruple extraction:</p>
<ul>
<li>1 5mL tube to contain the buffered plasma</li>
<li>2-4 cryo tubes for the extra plasma aliquots</li>
<li>labels for the aliquots</li>
<li>10 collection tubes</li>
<li>1 1.5mL tube</li>
<li>1 spin column (in a collection tube)</li>
</ul>
<p>Before using buffer AVL for the first time, check the buffer for
precipitate, and incubate at 80Â°C, if needed, until precipitate
dissolves. Add 1 mL of buffer AVL to the tube of lyophilized Carrier
RNA. Dissolve the RNA thoroughly and transfer back to the buffer bottle.
Mix thoroughly and aliquot 1.0mL into dated 1.5 mL tubes. Store at 4Â°C
and use within 6 months.</p><p>Before using buffers AW1 and AW2 for the first time, add the appropriate
amount of Et-OH. Mix thoroughly.</p>
<ol>
<li> All buffers should be at room temperature prior to use.</li>
<li> Label the 5mL tubes.</li>
<li> Pipet 2240Î¼L of Buffer AVL into each 5mL tube.</li>
<li> Add 560Î¼L of the plasma sample. Mix thoroughly by pipetting. (some
samples foam at this point)</li>
</ol>
<p>If cryoprecipitates are present in the thawed plasma sample, they can be
pelleted by briefly centrifuging at 6800 x g for 3 minutes. This step
will not reduce viral titers.</p>
<ol>
<li> Incubate at room temperature for 10 minutes.</li>
<li> Aliquot the remaining plasma, label tubes, and place in freezer.</li>
<li> After 10 minutes, add 2240Î¼L 96% Et-OH to the 5mL tube. Mix
thoroughly.</li>
<li> Remove 630Î¼L from the 5mL tube and apply it to the spin column.
Take care to not wet the rim.</li>
<li> Spin at 6000 x g for 1 min.</li>
<li>Place spin column in a clean collection tube and discard the tube
containing the filtrate.</li>
<li>Repeat the previous three steps until all the buffered plasma has
been applied to the column.</li>
<li>Label the 1.5mL tubes.</li>
<li>Wash the column with 500Î¼L of Buffer AW1.</li>
<li>Spin at 6000 x g for 1 min.</li>
<li>Place spin column in a clean collection tube and discard the tube
containing the filtrate.</li>
<li>Wash the column with 500Î¼L of Buffer AW2.</li>
<li>Centrifuge at full speed for 3 minutes. (20,000 x g)</li>
<li>Place spin column in a clean collection tube and discard the tube
containing the filtrate.</li>
<li>Centrifuge at full speed for 1 min.</li>
<li>Place the spin column in the labeled 1.5mL tube. Apply 40Î¼L of
Buffer AVE directly to the center of the membrane and incubate at
room temperature for 1 min.</li>
<li>Centrifuge at 6000 x g for 1 min.</li>
<li>Apply another 40Î¼L of Buffer AVE to the center of the membrane and
incubate at room temperature for 1 min.</li>
<li>Centrifuge at 6000 x g for 1 min.</li>
</ol>
<p>Place the 1.5mL tubes on foil and spray with 70% Et-OH. Make a packet
with the foil and spray the outside with 70% Et-OH before removing from
the BL3.</p><p>In the PCR room, aliquot 25Î¼L of the RNA into labeled 0.6mL tubes using
low retention tips.</p><p>Viral RNA is stable for up to 1 year when stored at -20Â°C or -70Â°C.</p><p>Proceed to cDNA reaction for one aliquot immediately following
extraction. This avoids a freeze/thaw of our sample and may allow a
greater chance of successful amplification.</p>
<h1>Whole Genome Reverse Transcription (Invitrogen RT Kit)</h1>

<ol>
<li> Mix per sample and preheat RT-PCR machine to 65Â°C:
<table>
<tbody>
<tr class="odd">
<td><br />
</td>
<td>RNA</td>
<td>~25Î¼L</td>
</tr>
<tr class="even">
<td><br />
</td>
<td>dNTP (20mM)</td>
<td>1.5Î¼L</td>
</tr>
<tr class="odd">
<td><br />
</td>
<td>oligo-dT (20pmol/Î¼L)</td>
<td>2.5Î¼L</td>
</tr>
</tbody>
</table></li>
<li> Start file#33 - heat at 65Â°C for 5 min</li>
<li> Reduce heat to 45Â°C (higher temp will inactivate RT!)</li>
<li> Add 20Î¼L of the following pre-warmed!!! mix per sample:
<table>
<tbody>
<tr class="odd">
<td><br />
</td>
<td>5x buffer</td>
<td>8Î¼L</td>
</tr>
<tr class="even">
<td><br />
</td>
<td>0.1M DTT</td>
<td>4Î¼L</td>
</tr>
<tr class="odd">
<td><br />
</td>
<td>Superscriptase III</td>
<td>2Î¼L</td>
</tr>
<tr class="even">
<td><br />
</td>
<td>RNase inhibitor</td>
<td>1Î¼L</td>
</tr>
<tr class="odd">
<td><br />
</td>
<td>dH<sub>2</sub>O</td>
<td>5Î¼L</td>
</tr>
</tbody>
</table></li>
<li> Incubate 1.5 hours at 45Â°C</li>
<li> Add additional 1.0Î¼L Superscriptase III, and incubate another 1.5
hours at 45Â°C</li>
<li> Inactivate for 15 min at 70Â°C</li>
<li> Add 1Î¼L RNase H and incubate for 20 min at 37Â°C</li>
<li> Label tube as cDNA and date. Freeze in Walker cDNA box.</li>
</ol>

<h1>Hot Start PCR</h1>

<table>
<thead>
<tr class="header">
<th>1st Round</th>
<th>Lower Premix</th>
<th><br />
</th>
<th>Upper Premix</th>
</tr>
</thead>
<tbody>
<tr class="odd">
<td>20 mM dNTP</td>
<td>0.9 Î¼L</td>
<td>DNA</td>
<td>1Î¼L</td>
</tr>
<tr class="even">
<td>50pmol/Î¼L 1.U5C</td>
<td>0.3 Î¼L</td>
<td>10X Buffer 1</td>
<td>5 Î¼L</td>
</tr>
<tr class="odd">
<td>50 pmol/Î¼L 1.U5Cb</td>
<td>0.3Î¼L</td>
<td>Expand enzyme</td>
<td>0.75 Î¼L</td>
</tr>
<tr class="even">
<td>50pmol/Î¼L 1.3.3plC</td>
<td>0.3 Î¼L</td>
<td>H<sub>2</sub>O</td>
<td>23.25 Î¼L</td>
</tr>
<tr class="odd">
<td>H<sub>2</sub>O</td>
<td>18.2 Î¼L</td>
<td>Total</td>
<td>30 Î¼L</td>
</tr>
<tr class="even">
<td>Total</td>
<td>20 Î¼L</td>
<td><br />
</td>
<td><br />
</td>
</tr>
<tr class="odd">
<td>Î¼L / sample</td>
<td><br />
</td>
<td>Î¼L/sample</td>
<td><br />
</td>
</tr>
</tbody>
</table>

<table>
<thead>
<tr class="header">
<th>2nd Round</th>
<th>Lower Premix</th>
<th><br />
</th>
<th>Upper Premix</th>
</tr>
</thead>
<tbody>
<tr class="odd">
<td>20 mM dNTP</td>
<td>0.9 Î¼L</td>
<td>1st round product</td>
<td>1Î¼L</td>
</tr>
<tr class="even">
<td>50pmol/Î¼L 2.U5C</td>
<td>0.3 Î¼L</td>
<td>10X Buffer 1</td>
<td>5 Î¼L</td>
</tr>
<tr class="odd">
<td>50pmol/Î¼L 2.3.3plC</td>
<td>0.3Î¼L</td>
<td>Expand enzyme</td>
<td>0.75 Î¼L</td>
</tr>
<tr class="even">
<td>H<sub>2</sub>O</td>
<td>18.5 Î¼L</td>
<td>H<sub>2</sub>O</td>
<td>23.25 Î¼L</td>
</tr>
<tr class="odd">
<td>Total</td>
<td>20 Î¼L</td>
<td>Total</td>
<td>30 Î¼L</td>
</tr>
<tr class="even">
<td>Î¼L / sample</td>
<td><br />
</td>
<td>Î¼L/sample</td>
<td><br />
</td>
</tr>
</tbody>
</table>
<p>dNTPs final concentration: 360 Î¼M</p><p>primers final concentrarion: 300nM</p><p>MgCl final concentration = 1.75 mM</p>
<h1>Cycle Profile: WHOLGENM</h1>

<table>
<tbody>
<tr class="odd">
<td>1x</td>
<td>94Â°</td>
<td>2'</td>
</tr>
<tr class="even">
<td>10x</td>
<td>94Â°</td>
<td>10&quot;</td>
</tr>
<tr class="odd">
<td><br />
</td>
<td>68Â°</td>
<td>30&quot;</td>
</tr>
<tr class="even">
<td><br />
</td>
<td>68Â°</td>
<td>8'</td>
</tr>
<tr class="odd">
<td>20x</td>
<td>94Â°</td>
<td>10&quot;</td>
</tr>
<tr class="even">
<td><br />
</td>
<td>68Â°</td>
<td>30&quot;</td>
</tr>
<tr class="odd">
<td><br />
</td>
<td>68Â°</td>
<td>8' + 20&quot;/cycle</td>
</tr>
<tr class="even">
<td>1x</td>
<td>68Â°</td>
<td>20'</td>
</tr>
<tr class="odd">
<td>1x</td>
<td>4Â°</td>
<td>forever</td>
</tr>
</tbody>
</table>

<h4>SET-UP (individual tubes and paraffin):</h4>

<ol>
<li> Place 1mL microfuge tube filled with paraffin in heat block (heated
to highest temp), place p200 tip in the wax to preheat (otherwise
wax will just solidify in the cold tip)</li>
<li> Make lower master mix for &ldquo;x&rdquo; number of reactions, keeping all
reagents cold on ice.</li>
<li> Aliquot 20Î¼L of mix to each PCR reaction tube (use 0.5mL dome-lid
thin-wall PCR tubes from Island Scientific)</li>
<li> Place lower tubes in the heat block and add 25Î¼L paraffin wax to
them &ndash; the wax will melt into the correct place</li>
<li> As soon as the wax melts, transfer them to your rack to cool (the
wax will form a layer over the lower reaction mix, there will be a
dimple in the middle of the wax plug but there should be no opening
through to your lower reaction mix)</li>
<li> Make your upper reaction master mix, keeping all reagents cold on
ice.</li>
<li> Aliquot 29Î¼L into each reaction tube on top of the wax</li>
<li> Add your sample template to each tube (upper mix)</li>
<li> Transfer the reactions to your bench to add the control DNA (use 10
copy to measure sensitivity for first and second rounds combined and
a 1000 copy control for individual rounds &ndash; if you can see a 1000
copy control after a single round, you&rsquo;re doing GREAT!)</li>
<li>Start the PCR machine (MJ) and allow the block to get to 80Â°C
before starting to load your samples</li>
</ol>
<p>Notes:</p>
<ul>
<li>These primers will only work on full-length virus that has both LTRs
&ndash; they will NOT work on pNL4-3</li>
</ul>

<h4>SET-UP (8-well strip tubes):</h4>

<ol>
<li> Place 8 well ultra-thin strip tubes (Island Scientific) into 96-well
cold block. Notice the numbering of the tubes and orient correctly.</li>
<li> Make lower master mix for &ldquo;x&rdquo; number of reactions, keeping all
reagents cold on ice.</li>
<li> Aliquot 20Î¼L of mix to each PCR reaction tube.</li>
<li> Add one Ampliwax pellet into each tube. Place strips in the heat
block unti wax melts.</li>
<li> As soon as the wax melts, transfer them to your cold block to cool
(the wax will form a layer over the lower reaction mix, there will
be a dimple in the middle of the wax plug but there should be no
opening through to your lower reaction mix)</li>
<li> Make your upper reaction master mix, keeping all reagents cold on
ice.</li>
<li> Aliquot 29Î¼L into each reaction tube on top of the wax.</li>
<li> Add your sample template to each tube (upper mix)</li>
<li> Transfer the reactions to your bench to add the control DNA (use 10
copy to measure sensitivity for first and second rounds combined
(nested) and a 1000 copy control for individual rounds &ndash; if you can
see a 1000 copy control after a single round, you&rsquo;re doing GREAT!)</li>
<li>Start the PCR machine (PE) and allow the block to get to 80Â°C
before inserting your samples.</li>
</ol>

<h1>PCR Gel Purification and Cloning (Invitrogen XL TOPO PCR Cloning Kit)</h1>

<h4><span class="underline">Gel Purification:</span></h4>

<ol>
<li> If the PCR product is several days old, add 0.5Î¼L of Bioline
biolase and incubate for 20 min at 72Â°C</li>
<li> Prepare 150mL 1% agarose gel TAE buffer, microwave heat for 4 min.</li>
<li> Add 90Î¼L of 2mg/mL of crystal violet, pour the gel and put the
combs which can hold all PCR(~40Î¼L) products</li>
<li> Add 8Î¼L of 6X crystal loading dye to 40Î¼L PCR product</li>
<li> Load all PCR products and 4Î¼g HindIII run 100V for around 2 hours
(note: skip one lane between each sample when you load the PCR
products. It helps you to cut the gel easily without contamination)</li>
<li> Cut the right size band, put into the pre-weighted 1.5mL tube and
weigh (usually i t weighs 100mg=100Î¼L)</li>
<li> Add 250Î¼L (2.5 volumes) of 6.6M sodium iodide and incubate at
42-50Â°C until the agarose is completely melted</li>
<li> Add 525Î¼L (1.5 volumes) of binding buffer and mix well</li>
<li> Load all of the mixture onto the column, spin at 3000xg for 30 sec</li>
<li>Pour the elution in the collection vial back onto the column and
repeat step 9</li>
<li>Repeat step 10 one more time to bind all the DNA to the column (a
total of 3 times)</li>
<li>After the last centrifugation, discard the flow-through in the
collection tube</li>
<li>Add 400Î¼L of 1X final wash (dilute the 4x wash with ethanol) to the
column and spin at 3000xg for 30 sec</li>
<li>Repeat step 13 and discard the flow-through in the collection tube
after the final centrifugation</li>
<li>Spin the column again at 10,000xg for 2 min to dry the column resin</li>
<li>Transfer the column to a new 1.5mL tube</li>
<li>Add 40Î¼L of TE buffer and incubate at room temp for 1 min</li>
<li>Spin at 10,000xg for 2 min</li>
<li>Assay 5Î¼L by EtBr agarose gel to estimate the DNA concentration</li>
<li>Proceed directly to the TOPO Cloning reaction</li>
</ol>

<h4><span class="underline">TOPO Cloning and Transformation:</span></h4>

<ol>
<li> Set up the following 5Î¼L cloning reaction per sample:
|                                |      |
| &mdash;&mdash;&mdash;&mdash;&mdash;&mdash;&mdash;&mdash;&mdash;&mdash; | &mdash;- |
| gel purified long PCR products | 4Î¼L |
| pCR-XL-TOPO vector             | 1Î¼L |</li>
<li> Mix gently and incubate for 5 min at room temp</li>
<li> Add 1Î¼L of the 6X TOPO cloning stop solution and place on ice</li>
<li> Add 2Î¼L of the cloning reaction into a vial of pre-thawed One Shot
cells and mix gently (Do not mix by pipetting up and down)</li>
<li> Incubate on ice for 30 min</li>
<li> Heat shock the cells for 45 sec at 42Â°C without shaking</li>
<li> Immediately transfer the cells to ice and incubate for 2 min</li>
<li> Add 250Î¼L of SOC medium</li>
<li> Shake the tube horizontally at 37Â°C for 1 hour</li>
<li>Spread 150Î¼L from the transformation on a pre-warmed LB plate
containing 50Î¼g/mL Kanamycin</li>
<li>Incubate the plate overnight at 30Â°C</li>
</ol>

<h1>Plasmid mini prep (QIAgen QIAprep Spin Column Miniprep)</h1>
<p><strong><span class="underline">Note:</span></strong></p>
<ol>
<li> After digestion, check the insert by agarose gel. Run gel at 25V
overnight</li>
<li> Once you have identified the correct clone, make a glycerol stock
for long term storage. 500 Î¼L of culture plus 75 Î¼L of glycerol.
Mix well and snap freeze in ethanol/dry ice bath.</li>
</ol>

<h1>Plasmid midi prep (Sigma GenElute HP Plsmid Midiprep)</h1>

<ol>
<li> Re-plate glycerol stock on LB kanamycin (50Î¼g/mL) plate. Incubate
at 30Â°C overnight.</li>
<li> Streak a single colony out and inoculate a 3mL culture for 8-12
hours. Add this culture to 100mL of LB kanamycin (50Î¼g/mL) media,
shake overnight at 200rpm in 30Â°C incubator.</li>
<li> Midi prep (see kit protocol)</li>
<li> Elute in 1.5mL of dH<sub>2</sub>O</li>
<li> To check the insert, digest 2Î¼L of DNA by EcoRI</li>
<li> After digestion, check the insertion size by 1% agarose gel. Run gel
at 25V overnight</li>
<li> Determine the concentration by OD260 (1:50 dilution)</li>
<li> Dilute to 200 ng/Î¼L or precipitate and resuspend to 200 ng/Î¼L.</li>
</ol>

<h1>Sequencing:</h1>
<p>Send 10Î¼L of 200 ng/Î¼L plasmid DNA combined with 7.5Î¼L of 1Î¼M primer
in a 96 well plate. This is enough for 2.5 reactions.</p>

]]>
        </content>
    </entry>
    
    <entry>
        <title>Long PCR</title>
        <link href="https://viroverse.washington.edu/protocols/molecular_biology/2646-Long-PCR" rel="alternate" type="text/html" />
        <published>2010-04-01T16:25:39-07:00</published>
        <updated>2011-06-03T15:52:01+00:00</updated>
        <id>urn:uuid:a4921b8f-413c-5b52-8dc0-c808664bea72</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p><strong>Two long PCR steps:</strong></p>
<ol>
<li><p> First round of the nested PCR step of the end point dilution
procedure to quantitate the cDNA.</p></li>
<li><p> First round of the nested PCR step of the limiting dilution step to
amplify single templates. The conditions are exactly the same both
times.</p></li>
</ol>
<p><strong>Reaction Composition</strong></p>
<table>
<colgroup>
<col style="width: 33%" />
<col style="width: 33%" />
<col style="width: 33%" />
</colgroup>
<tbody>
<tr class="odd">
<td>H<sub>2</sub>O</td>
<td>35.5 ÂµL</td>
<td><br />
</td>
</tr>
<tr class="even">
<td>10x Buffer + 15 mM MgCl<sub>2</sub></td>
<td>5.0 ÂµL</td>
<td>final [Mg<sup>2+</sup>] = 1.5 mM</td>
</tr>
<tr class="odd">
<td>dNTP</td>
<td>6.0 ÂµL</td>
<td>final [dNTP] = 300 ÂµM each</td>
</tr>
<tr class="even">
<td>DS3 (4895-4924)</td>
<td>1.0 ÂµL</td>
<td>final [primer] = 0.2 ÂµM</td>
</tr>
<tr class="odd">
<td>DS8 (9550-9521)</td>
<td>1.0 ÂµL</td>
<td>final [primer] = 0.2 ÂµM</td>
</tr>
<tr class="even">
<td>Enzyme (3.5 U/ÂµL)</td>
<td>0.5 ÂµL</td>
<td>final enzyme amount = 1.75 U</td>
</tr>
<tr class="odd">
<td>Template (cDNA)</td>
<td>1.0 ÂµL</td>
<td><br />
</td>
</tr>
<tr class="even">
<td><hr /></td>
<td><hr /></td>
<td><br />
</td>
</tr>
<tr class="odd">
<td>Total</td>
<td>50.0 ÂµL</td>
<td><br />
</td>
</tr>
</tbody>
</table>
<p>Primer positions are given for NL4-3, and yield a product ~4.6 kb. The
enzyme and buffer are from Boehringer Mannheimï¿½s Expandï¿½ High
Fidelity PCR System.</p><p><span class="underline"><strong>Cycling Conditions</strong></span></p>
<ol>
<li><p> 94Â°C for 2 min, 30 sec</p></li>
<li><p> 94Â°C for 15 sec - 55Â°C for 45 sec - 68Â°C for 6 min for 9 cycles</p></li>
<li><p> 94Â°C for 15 sec - 57Â°C for 45 sec - 68Â°C for 6 min, 20 sec for 19
cycles</p></li>
<li><p> 72Â°C for 30 min</p></li>
<li><p> 4Â°C soak</p></li>
</ol>
<p><span class="underline"><strong>Sensitivity</strong></span></p>
<ul>
<li><p>Presumably one copy of pNL4-3 and one copy of cDNA.</p></li>
<li><p>Provirus (8E5 cells, with one provirus per cell) down to 100 copies.</p></li>
</ul>
<p><span class="underline"><strong>Specificity</strong></span></p>
<ul>
<li><p>Nothing detected from uninfected human placental DNA.</p></li>
<li><p>No apparent false priming</p></li>
</ul>


]]>
        </content>
    </entry>
    
    <entry>
        <title>Purification of PCR Products (96-wells Format)</title>
        <link href="https://viroverse.washington.edu/protocols/molecular_biology/1552-Purification-of-PCR-Products-96-wells-Format" rel="alternate" type="text/html" />
        <published>2010-04-01T16:24:59-07:00</published>
        <updated>2011-06-03T15:52:17+00:00</updated>
        <id>urn:uuid:f494d97e-dec0-55cb-8986-ea077c2fdb86</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p><span class="underline"><strong>Reagents</strong></span></p>
<table>
<colgroup>
<col style="width: 50%" />
<col style="width: 50%" />
</colgroup>
<tbody>
<tr class="odd">
<td><p>Binding buffer</p></td>
<td><p>7 M Guanidine-HCl in 200 mM MES buffer pH5.6 or<br />
5.3 M Guanidine-HCl in 150 mM KAc buffer pH4.8</p></td>
</tr>
<tr class="even">
<td><p>Glass fiber filter plate</p></td>
<td><p>Millipore multiscreen-FB filter plates, MAFB NOB 50</p></td>
</tr>
<tr class="odd">
<td><p>Catch plate</p></td>
<td><p>VWR, 622409-108</p></td>
</tr>
<tr class="even">
<td><p>Wash solutions</p></td>
<td><p>80% Ethanol</p></td>
</tr>
<tr class="odd">
<td><p>Elution buffer</p></td>
<td><p>10 mM Tris pH 8.0</p></td>
</tr>
</tbody>
</table>
<p><span class="underline"><strong>Protocol</strong></span></p>
<ol>
<li><p> Aliquot 150 Âµl of binding buffer to 50 Âµl of PCR product.
Thoroughly mix by vigorously pipetting up and down at least 5 times
(complete mixing is important).</p></li>
<li><p> Transfer mixture to 96-well filter plate.</p></li>
<li><p> Put filter plate with centrifuge alignment frame (Millipore) on top
of 96-well catch plate.</p></li>
<li><p> Spin liquid through filter, into 96-well catch plate (1000x g for 5
min).</p></li>
<li><p> Discard filtrate, save catch plate for reuse.</p></li>
<li><p> Add 200 Âµl of 80% ethanol to each well of filter plate.</p></li>
<li><p> Spin liquid through filter, into 96-well catch plate (1000x g for 3
min).</p></li>
<li><p> Discard filtrate, save catch plate for reuse.</p></li>
<li><p> Repeat 80% ethanol wash (steps 6-8) 1 to 4 times.</p></li>
<li><p>Do one dry spin to remove residual ethanol (1000x g for 5 min).</p></li>
<li><p>Add 50 Âµl of 10 mM Tris-HCl pH 8.0 (preheated to 65Â°C) to each
well. Incubate 1 minute.</p></li>
<li><p>To elute purified DNA, place the filter plate on top of a clean
96-well catch plate along with a centrifuge alignment frame and spin
(1000x g for 5 min)</p></li>
</ol>
<p>The PCR product is in the eluent. Transfer 10 Âµl to a clean catch plate
with 10 Âµl DMSO in each well. Seal plates carefully with aluminium
foil. Store both plates at -20Â°C.</p>

]]>
        </content>
    </entry>
    
    <entry>
        <title>Freezerworks Maps</title>
        <link href="https://viroverse.washington.edu/protocols/data_analysis/2496-Freezerworks-Maps" rel="alternate" type="text/html" />
        <published>2010-04-01T16:24:16-07:00</published>
        <updated>2011-06-03T15:52:57+00:00</updated>
        <id>urn:uuid:03cab83e-df71-57b8-843b-748329ab3705</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p>Getting the Data From Freezerworks</p><p>The mapping macro generates one map per freezer box, but it&rsquo;s quickest
to pull the data out by one freezer at a time.</p>
<ul>
<li>Log in to Freezerworks. If you don&rsquo;t know how, you should get help
from Tara (queen of the Freezer people)</li>
<li>From the <code>Samples</code> menu, choose <code>Search by Location</code></li>
<li>Select the Freezer you want to export. Leave the <code>Rack</code>, <code>Box</code>,
<code>Position</code> boxes blank to select all of the samples in the freezer.</li>
<li>Open the <code>Import/Export</code> menu and choose <code>Export Data</code>.</li>
<li>Double-click the <code>Map Maker</code> export format.</li>
<li>Make sure the <code>Field Delimiter</code> is still <code>tab</code> and the <code>Record
Delimiter</code> is <code>return</code> and that <code>Include Header Record</code> is checked.</li>
<li>Click the <code>Save Export</code> button and note where you save the file for
the next step</li>
</ul>
<p>Creating the Freezer Data File in Excel</p><p>Open a new Excel worksheet</p><p><code>Choose Data Get External Data Import Text File</code></p><p>select the freezerworks file you created in step 1</p><p>click <code>Finish</code> to accept the defaults and import the data</p><p>Fill the empty <code>Subdivision 5</code> column with spaces:</p>
<ul>
<li>enter a space in the top of the column (probably cell C2)</li>
<li>select that cell and everything below it (shift + cmd + down arrow)</li>
<li>choose <code>Edit Fill Down</code></li>
</ul>
<p>Sort the data by position</p>
<ul>
<li>Select all of the data (cmd + A or edit select all)</li>
<li>Choose <code>Data Sort</code></li>
<li>Sort by <code>Subdivision 1 Position</code>, then <code>Subdivision 2 position</code>,
then <code>Subdivision 3 Position</code> with a <code>Header row</code></li>
</ul>
<p>Create a Map of the Data for a Box</p>
<ul>
<li>If you plan to save, create a copy of the <code>MapMaker Blank.xls</code> file.
You can find it in the &lsquo;Freezerworks Webinars&rsquo; folder on transfer if
necessary.</li>
<li>Copy and paste the rows corresponding to a single box from the
freezer worksheet into the &lsquo;Paste Data&rsquo; worksheet of the Map Maker
file. The shelf column should be blank because we don&rsquo;t use that
subdivision.</li>
<li>Press <code>ctrl+a</code>
to activate the magic. The data in the Paste Data tab will be
transformed into a map of the box on the Map tab.</li>
<li>Print or save as you like. (you may need to redefine the print area
to include the line numbers)</li>
</ul>


]]>
        </content>
    </entry>
    
    <entry>
        <title>Gel Loading Scheme</title>
        <link href="https://viroverse.washington.edu/protocols/molecular_biology/696-Gel-Loading-Scheme" rel="alternate" type="text/html" />
        <published>2010-04-01T16:22:37-07:00</published>
        <updated>2011-06-03T15:53:15+00:00</updated>
        <id>urn:uuid:6b51bcc9-b4ed-5ea4-8d38-d6ee42b44e23</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p>Check PCR products on 1% Agarose gel (2-3 Âµl PCR product in 15 Âµl
total loading volume)</p><p><span class="underline">For gels with 42 tooth combs:</span></p><p>M A1 B1 A2 B2 ï¿½ A11 B11 A12 B12 M</p><p>M C1 D1 C2 D2 ï¿½ C11 D11 C12 D12 M</p>
<h1>M E1 F1 E2 F2 ï¿½ E11 F11 E12 F12 M</h1>
<p>M G1 H1 G2 H2 ï¿½ G11 H11 G12 H12 M</p><p><span class="underline">For gels with 50 tooth combs:</span></p><p>M A1 B1 A2 B2 ï¿½ A11 B11 A12 B12 M E1 F1 E2 F2 ï¿½ E11 F11 E12 F12</p><p>M C1 D1 C2 D2 ï¿½ C11 D11 C12 D12 M G1 H1 G2 H2 ï¿½ G11 H11 G12 H12</p><p>Marker is 1 kb ladder (GIBCO-BRL).</p><p>Run approximately 2 hours (bromophenol blue marker 2/3 down lane).</p>

]]>
        </content>
    </entry>
    
    <entry>
        <title>PCR Conditions (96-Well Format)</title>
        <link href="https://viroverse.washington.edu/protocols/molecular_biology/238-PCR-Conditions-96-Well-Format" rel="alternate" type="text/html" />
        <published>2010-04-01T16:19:18-07:00</published>
        <updated>2011-06-03T15:53:37+00:00</updated>
        <id>urn:uuid:922227d0-0e3a-5339-819d-2c686e359c03</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<ol>
<li><p> Perform PCR reactions in 50 Âµl using 2 Âµl of colony from plate C
(primers are VNG26/27 or equivalents, enzyme ISC-Biolase or
Promega-Taq).</p></li>
<li><p> Check PCR on gel, load according to standard loading scheme.</p></li>
<li><p> Log clones that did not yield product on appropriate sheet.</p></li>
<li><p> Purify and array PCR products on glass slides.</p></li>
<li><p> Select 8 clones from each plate for sequencing (usually one clone
from each column with a good PCR product from gel analysis. If
possible, include A1 and H12 to check orientation of plate).</p></li>
</ol>
<p><strong>Standard Mix:</strong></p><p>Add 48 Âµl mix to 2Âµl cells in 96-well PCR plate (ISC, T-3049-1).</p>
<table style="width:100%;">
<colgroup>
<col style="width: 14%" />
<col style="width: 14%" />
<col style="width: 14%" />
<col style="width: 14%" />
<col style="width: 14%" />
<col style="width: 14%" />
<col style="width: 14%" />
</colgroup>
<tbody>
<tr class="odd">
<td></td>
<td><h2 id="stock" style="line-height: 150%; margin-top: 0px; margin-bottom: 0px;">Stock</h2></td>
<td><h2 id="brand" style="line-height: 150%; margin-top: 0px; margin-bottom: 0px;">Brand</h2></td>
<td><h2 id="cat.no." style="line-height: 150%; margin-top: 0px; margin-bottom: 0px;"><span class="underline">Cat.no.</span></h2></td>
<td style="text-align: left;"><h2 id="x" style="line-height: 150%; margin-top: 0px; margin-bottom: 0px;"><span class="underline">1x</span></h2></td>
<td><h2 id="x-1" style="line-height: 150%; margin-top: 0px; margin-bottom: 0px;"><span class="underline">100x</span></h2></td>
<td><h2 id="x-2" style="line-height: 150%; margin-top: 0px; margin-bottom: 0px;"><span class="underline">103x</span></h2></td>
</tr>
<tr class="even">
<td><p>Water</p></td>
<td></td>
<td><p>Sigma</p></td>
<td><p>W4502</p></td>
<td style="text-align: left;"><p>40.8</p></td>
<td><p>4080</p></td>
<td><p>4202.4</p></td>
</tr>
<tr class="odd">
<td><p>10x Buffer</p></td>
<td><p>10x</p></td>
<td><p>ISC</p></td>
<td></td>
<td style="text-align: left;"><p>5.0</p></td>
<td><p>500</p></td>
<td><p>515.0</p></td>
</tr>
<tr class="even">
<td><p>MgCl<sub>2</sub></p></td>
<td><p>50 mM</p></td>
<td><p>ISC</p></td>
<td></td>
<td style="text-align: left;"><p>1.5</p></td>
<td><p>150</p></td>
<td><p>154.5</p></td>
</tr>
<tr class="odd">
<td><p>DNTP mix</p></td>
<td><p>20 mM</p></td>
<td><p>Pharmacia</p></td>
<td><p>27-2035-02</p></td>
<td style="text-align: left;"><p>0.3</p></td>
<td><p>30</p></td>
<td><p>30.9</p></td>
</tr>
<tr class="even">
<td><p>Primer-mix</p></td>
<td><p>30 ÂµM</p></td>
<td><p>GibcoBRL</p></td>
<td></td>
<td style="text-align: left;"><p>0.2</p></td>
<td><p>20</p></td>
<td><p>20.6</p></td>
</tr>
<tr class="odd">
<td><p>Biolase</p></td>
<td><p>5 U/Âµl</p></td>
<td><p>ISC</p></td>
<td><p>C-5002-500</p></td>
<td style="text-align: left;"><p>0.2</p></td>
<td><p>20</p></td>
<td><p>20.6</p></td>
</tr>
</tbody>
</table>
<p><strong>Cycling:</strong></p>
<table>
<colgroup>
<col style="width: 33%" />
<col style="width: 33%" />
<col style="width: 33%" />
</colgroup>
<tbody>
<tr class="odd">
<td><p>Temperature</p></td>
<td><p>Time</p></td>
<td><p>Cycles</p></td>
</tr>
<tr class="even">
<td><p>94Â°</p></td>
<td><p>5ï¿½</p></td>
<td><p>1</p></td>
</tr>
<tr class="odd">
<td><p>94Â°</p>
<p>58Â°</p>
<p>72Â°</p></td>
<td><p>30ï¿½</p>
<p>30ï¿½</p>
<p>4ï¿½</p></td>
<td><p>40</p></td>
</tr>
<tr class="even">
<td><p>72Â°</p></td>
<td><p>10ï¿½</p></td>
<td><p>1</p></td>
</tr>
<tr class="odd">
<td><p>4Â°</p></td>
<td><p>Hold</p></td>
<td></td>
</tr>
</tbody>
</table>
<p>When using an Eppendorf repeat pipetter, make enough for 103 reactions
and dispense 50 Âµl per well.</p><p>This protocol is also used for the PE 9600. Run takes 4 hours on PE 9700
and more than 4.5 hours on PE 9600.</p><p>**<br>
**</p><p><strong><span class="underline">GEL LOADING SCHEME</span></strong></p><p>Check PCR products on 1% Agarose gel (2-3 Âµl PCR product in 15 Âµl
total loading volume)</p><p>For gels with 42 tooth combs:</p><p>M A1 B1 A2 B2 ï¿½ A11 B11 A12 B12 M</p><p>M C1 D1 C2 D2 ï¿½ C11 D11 C12 D12 M</p><p>M E1 F1 E2 F2 ï¿½ E11 F11 E12 F12 M</p><p>M G1 H1 G2 H2 ï¿½ G11 H11 G12 H12 M</p><p>For gels with 50 tooth combs:</p><p>M A1 B1 A2 B2 ï¿½ A11 B11 A12 B12 M E1 F1 E2 F2 ï¿½ E11 F11 E12 F12</p><p>M C1 D1 C2 D2 ï¿½ C11 D11 C12 D12 M G1 H1 G2 H2 ï¿½ G11 H11 G12 H12</p><p>Marker is 1 kb ladder (GIBCO-BRL).</p><p>Run approximately 2 hours (bromophenol blue marker 2/3 down lane).</p>

]]>
        </content>
    </entry>
    
    <entry>
        <title>Replication of cDNA Clones (96-Wells Format)</title>
        <link href="https://viroverse.washington.edu/protocols/molecular_biology/1960-Replication-of-cDNA-Clones-96-Wells-Format" rel="alternate" type="text/html" />
        <published>2010-04-01T16:17:58-07:00</published>
        <updated>2011-06-03T15:54:22+00:00</updated>
        <id>urn:uuid:a7de8aa7-2a67-5e64-83a6-a8dc83c3950d</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p><span class="underline"><strong>A+B</strong><br>
</span></p><p><span class="underline"></span></p>
<ol>
<li><p> Fill appropriate number of 96-well plates with 110 ÂµL LB-Amp.</p></li>
<li><p> Use 96-pin sterile replicators to replicate each original into 2 new
plates, A and B.</p></li>
<li><p> Make sure rows and columns are aligned correctly (this is NOT
obvious!).</p></li>
<li><p> Grow o/n (~ 20 hrs) at 37 Â°C in humid chamber (wet paper towels in
container covered loosely).</p></li>
<li><p> Log clones that did not grow on appropiate sheet.</p></li>
<li><p> Include number of plate, date, initials.</p></li>
<li><p> Seal plates with aluminium foil.</p></li>
<li><p> Spin plates 10 min at 2000 rpm.</p></li>
<li><p> Using Transtar 96-well pipet, take off supernatant. Wash Transtar
cartridge between aspirating plates as follows:<br>
Set up 3 pipet tip box lids; one filled with 10% bleach, two with
sterile water.</p>
<ol>
<li> Pipet up/down in 10% bleach.</li>
<li> Rinse by pipetting in first container of sterile water.</li>
<li> Rinse again in second container of sterile water.</li>
</ol></li>
<li><p>Add 100 ÂµL LB-Amp/15% glycerol using clean Transtar apparatus.</p></li>
<li><p>Seal plates with aluminium foil.</p></li>
<li><p>Vortex briefly to resupend pellet.</p></li>
<li><p>Store at -80Â°C, original and plates A for Bumgarner, plates B for
Katze/Mullins.</p></li>
</ol>
<p><strong><span class="underline"><br>
</span></strong></p><p>**<span class="underline">C</span><br>
**</p>
<hr>

<ol>
<li><p> Fill appropriate number of 96-well plates with 110 ÂµL LB-Amp.</p></li>
<li><p> Thaw plates B for ~10 min.</p></li>
<li><p> Spin plates 1 min at 2000 rpm.</p></li>
<li><p> Use 96-pin sterile replicators to replicate each plate B into 1 new
plate, C.</p></li>
<li><p> Grow o/n at 37Â°C in humid chamber.</p></li>
<li><p> Log clones that did not grow on appropriate sheet.</p></li>
<li><p> Include number of plate, date, initials.</p></li>
<li><p> Seal plates with aluminium foil.</p></li>
<li><p> Store at -80Â°C, plate C for Katze/Mullins</p></li>
</ol>


]]>
        </content>
    </entry>
    
    <entry>
        <title>Processing Q-Bot Membranes</title>
        <link href="https://viroverse.washington.edu/protocols/microarrays/692-Processing-Q-Bot-Membranes" rel="alternate" type="text/html" />
        <published>2010-04-01T16:17:05-07:00</published>
        <updated>2011-06-03T15:56:58+00:00</updated>
        <id>urn:uuid:89f6196a-ac73-557a-9d6a-bcca7cc829c2</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p><span class="underline"><strong>Reagents</strong>:</span></p>
<table>
<thead>
<tr>
<th></th>
<th></th>
</tr>
</thead>

<tbody>
<tr>
<td>Whatman</td>
<td>23x23</td>
</tr>
<tr>
<td>Boiling waterbath</td>
<td>95 Â°C</td>
</tr>
<tr>
<td>Denaturing Solution</td>
<td>0.5M NaOH, 1.5M NaCl</td>
</tr>
<tr>
<td>Neutralizing Solution</td>
<td>1M Tris-Cl pH 7.4, 1.5M NaCl</td>
</tr>
<tr>
<td>PROPK Solution</td>
<td>50mM Tris-Cl pH8.5, 50mM EDTA, 100mM NaCl, 1% Na-lauroyl-sarcosine</td>
</tr>
<tr>
<td>Proteinase K</td>
<td>500mg/9ml, use 3ml per 600ml PROPK</td>
</tr>
</tbody>
</table>
<p><span class="underline"><strong>Protocol</strong>:</span></p>
<ol>
<li><p> Observe membrane and note any abnormalities about growth after
spotting. Check pencil numbers and robot puncture marks.</p></li>
<li><p> Handle membrane with 2 forceps holding it for diagonal corners.</p></li>
<li><p> Place on Whatman pre-wetted in Denaturing Solution. Leave for 4
minutes.</p></li>
<li><p> Place membrane on fresh Whatman pre-wetted in Denaturing Solution
and transfer to glass plate sitting on empty pipette tip box in
boiling waterbath. Leave for 4 minutes with covered lid.</p></li>
<li><p> Place membrane on Whatman pre-wetted in Neutratlizing Solution.
Leave for 4 minutes.</p></li>
<li><p> Place membrane on dry Whatman. Leave for 1 minute.</p></li>
<li><p> Submerge membrane under a 600ml pre-warmed (37 Â°C) PROPK Solution
containing ~150mg/ml <em>fresh</em> Proteinase K. Do NOT shake. Leave in
incubator for 30-50 minutes.</p></li>
<li><p> Place membrane on dry Whatman.</p></li>
<li><p> Cover with a NUNC. Leave overnight.</p></li>
<li><p>UV cross-link.</p></li>
<li><p>Store between dry Whatmans.</p></li>
</ol>


]]>
        </content>
    </entry>
    
    <entry>
        <title>Radiolabeled First-Strand cDNA Synthesis</title>
        <link href="https://viroverse.washington.edu/protocols/microarrays/352-Radiolabeled-First-Strand-cDNA-Synthesis" rel="alternate" type="text/html" />
        <published>2010-04-01T16:16:24-07:00</published>
        <updated>2011-06-03T15:57:26+00:00</updated>
        <id>urn:uuid:2249ddcc-dd8c-547d-b41d-25c4dcc8227e</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p><span class="underline"><strong>Protocol</strong></span> ****</p><p><strong>Denaturation</strong></p><p>1. Prepare the following:</p><p>25 Âµg total RNA/ 1Âµg poly A<sup>+</sup> RNA x Âµl</p><p>1 Âµg oligo dT<sub>19</sub>V (2 Âµg/Âµl) 0.5 Âµl</p><p>8 Âµg oligo dT<sub>30</sub> (8Âµg/Âµl) 1.0 Âµl</p><p>GFP poly A<sup>+</sup> RNA (10ng/Âµl) 0.5 Âµl</p><p>ddH<sub>2</sub>O <span class="underline">x Âµl</span></p><p>Final volume 10.5 Âµl</p><p>2. Heat at 70 Â°C for 10 minutes, cool to 42 Â°C, slowly.</p><p>Note: Heat in 70 Â°C heat block then take out block and allow to cool on
bench top until temp is 42 Â°C.</p><p><strong>Reverse Transcription</strong></p><p>3. To sample from above add the following:</p><p>dNTP mix (800 ÂµM dATP/dGTP/dTTP, 5 ÂµM dCTP) 1.0 Âµl</p><p>5x First Strand Buffer 5.0 Âµl</p><p>10x DTT 2.5 Âµl</p><p>[Î±-<sup>32</sup>P]-dCTP (10ÂµCi/Âµl) 5.0 Âµl</p><p>SuperScript II (200 U/Âµl) <span class="underline">1.0 Âµl</span></p><p>Final volume 25.0 Âµl</p><p>4. Incubate at 42 Â°C for 1 hour.</p><p><strong>Hydrolysis of RNA</strong></p><p>5. Sequentially add the following:</p><p>1% SDS 1.0 Âµl</p><p>500 mM EDTA 1.0 Âµl</p><p>2 N NaOH 3.0 Âµl</p><p>6. Heat at 65 Â°C for 5 minutes</p><p>7. Then add the following:</p><p>1 M Tris.HCl pH 7.6 10.0 Âµl</p><p>2 N HCl 3.0 Âµl</p><p>8. Incubate at RT for 10 minutes.</p><p>9. Add ddH<sub>2</sub>O <span class="underline">7.0 Âµl</span></p><p>Final volume 50.0 Âµl</p><p>10. Purify probe over G-50 Micro Column (Pre-spin col umn at 3500 rpm
for 1 minute, apply probe to column, spin at 3500 rpm for 2 minutes.)</p><p>Note: Save 1Âµl for counting and 1Âµl for denaturing gel.</p><p><strong>Prehyb membrane</strong></p><p>11. Incubate filter at 65 Â°C for 6-20 hrs in 10 ml Hybridization
solution (5x SSC, 5x Denhardtï¿½s, 0.5% SDS, 100 Âµg/ml ssDNA)</p><p><span class="underline">5ml</span> <span class="underline">10ml</span>
<span class="underline">15ml</span> <span class="underline">20ml</span>
<span class="underline">25ml</span> <span class="underline">30ml</span>
<span class="underline">50ml</span></p><p>20x SSC 1.25 2.50 3.75 5.00 6.25 7.50 12.5</p><p>50x Denhardtï¿½s 0.50 1.00 1.50 2.00 2.50 3.00 5.00</p><p>20% SDS 0.13 0.25 0.38 0.50 0.63 0.75 1.25</p><p>ssDNA 0.05 0.10 0.15 0.20 0.25 0.30 0.50</p><p>ddH<sub>2</sub>O 3.10 6.20 9.20 12.3 15.4 18.5 30.8</p><p><strong>Probe preparation</strong></p><p>12. Boil probe 5 minutes, place on ice at least 5 minutes.</p><p>13. Add 2 Âµg poly A<sub>72</sub> to 2 ml Hybridization solution.</p><p>14. Add denatured probe to the 2 ml Hybridization solution.</p><p>15. Incubate 1 hr at 65 Â°C.</p><p>16. Add 3 ml Hybridization solution.</p><p><strong>Hyb membrane</strong></p><p>17. Incubate filter in 5 ml Hybridization solution for 20 hrs at 65
Â°C.</p><p><strong>Washes</strong></p><p>18. Wash membrane 5 minutes at RT in 2x SSC/0.1% SDS.</p><p>19. Wash membrane 20 minutes at 65 Â°C in 2x SSC/0.1% SDS.</p><p>20. Wash membrane 1 hour at 65 Â°C in 0.1x SSC/0.1% SDS.</p><p>21 (Optional). If needed, repeat 1 hour at 65 Â°C 0.1x SSC/0.1% SDS.</p><p><em>Adapted from Huntsman Cancer Institute Katze Lab Protocols</em></p>

]]>
        </content>
    </entry>
    
    <entry>
        <title>Oligonucleitide Hybridization to Glass Arrays</title>
        <link href="https://viroverse.washington.edu/protocols/microarrays/591-Oligonucleitide-Hybridization-to-Glass-Arrays" rel="alternate" type="text/html" />
        <published>2010-04-01T16:15:45-07:00</published>
        <updated>2011-06-03T15:58:18+00:00</updated>
        <id>urn:uuid:cbadffc6-89ab-557a-b3cc-ada951248e70</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p>1. (optional) Prescan slide in Array Scanner II to determine quality of
slide (Note: I usually only do this in the green channel (532nm) to save
time.</p><p>2. Prepare 0.3 to 1 pmole of each Cy<sup>3</sup> or Cy<sup>5</sup>
labeled primer in 50Âµl 1X hybridization solution (50% formamide, 5X
SSC, 0.1% SDS, 100Âµg/ml salmon sperm DNA).</p><p>3. Pipet 50Âµl hyb solution with probe onto long edge of slide.</p><p>4. Cover with long cover slip, avoid air bubbles (gives high
background).</p><p>5. Incubate overnight (12hrs) at room temperature in humid chamber
(moist paper towel in bottom of relatively airtight container).</p><p>6. To remove coverslip, submerge slide in 2X SSC/0.2% SDS.</p><p><strong>Turn on scanner now if you want to scan immediately after processing,
scanner needs at least 40 minutes to warm up.</strong></p><p>7. Wash 5 min in 2X SSC/0.2% SDS at room temperature.</p><p>8. Wash10 min at room temp with 2X SSC/0.1% SDS.</p><p>9. Rinse slide 10 seconds in ddH<sub>2</sub>0.</p><p>10. Dry with compressed air.</p><p>11. Store in dark until ready to scan.</p><p>12. Scan in Array Scanner II in both channels (<strong>make sure scanner has
had at least 40 minutes to warm up</strong>).</p>

]]>
        </content>
    </entry>
    
    <entry>
        <title>RT-PCR</title>
        <link href="https://viroverse.washington.edu/protocols/microarrays/874-RT-PCR" rel="alternate" type="text/html" />
        <published>2010-04-01T16:15:07-07:00</published>
        <updated>2011-06-03T15:58:26+00:00</updated>
        <id>urn:uuid:dc95955b-0c52-5a72-84e0-38bcd04a822e</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p>18 June 2002</p><p><span class="underline"><strong>Reagents:</strong></span></p>
<ul>
<li>Forward Gene Specific Primer (IDT)</li>
<li>Reverse Gene Specific Primer (IDT)</li>
<li>Random decamer primer (from Ambion RetroScript Kit: 1710,
$206.00/kit or Ambion, 5722G, $50.00/80Âµl)</li>
<li>RNase Inhibitor (from Ambion RetroScript Kit: 1710, $206.00/kit)</li>
<li>Reverse Transcriptase (M-MLV) (5x RT Buffer from Ambion RetroScript
Kit: 1710, $206.00/kit)</li>
<li>10x RT Buffer, otherwise referred to as 10x first strand buffer
(from Ambion RetroScript Kit: 1710, $206.00/kit)</li>
<li>10x PCR Reaction Buffer (from Ambion RetroScript Kit: 1710,
$206.00/kit)</li>
<li>50 mM MgCl<sub>2</sub> (from Ambion RetroScript Kit: 1710,
$206.00/kit)</li>
<li>SuperTAQ DNA Polymerase (Ambion, 2050, $48.00/50 U or 2052,
$190.00/250U)</li>
<li>18S rRNA PCR Primer Pair (Ambion kit, 1716 $155.00/kit)</li>
<li>Control Template RNA (Ambion kit, 1716 $155.00/kit)</li>
</ul>
<p><strong><span class="underline">Protocol:</span></strong></p><p><strong><span class="underline"></span></strong></p><p><strong><span class="underline"></span></strong></p>
<h4>Reverse Transcription</h4>

<ol>
<li><p> Adjust concentration of RNA to 100 ng/Âµl (The RNA should be DNase
treated or equivalent).</p></li>
<li><p> Set up two 500 Âµl tubes: mark one tube as (-)RT control &ndash; it will
have no reverse transcriptase; mark the other with the sample name.
Both tubes will will contain the same sample RNA.</p></li>
<li><p> For each tube mix together:  </p><p>RNA (100-450ng) 2 Âµl<br>
Ramdom decamer (in excess) 2 Âµl<br>
<span class="underline">H<sub>2</sub>O to equal total volume</span>
<span class="underline">8 Âµl</span><br>
Total volume 12 Âµl<br>
For a positive control use 2 Âµl of the RNA Control Template
(Ambion).</p></li>
<li><p> Heat at 75Â°C for ten minutes; briefly centrifuge and keep on ice 30
seconds or until ready.</p></li>
<li><p> While heating above, prepare the RT Reaction Cocktail for the
sample(s) and the controls (separate):  </p>
<table>
<colgroup>
<col style="width: 25%" />
<col style="width: 25%" />
<col style="width: 25%" />
<col style="width: 25%" />
</colgroup>
<tbody>
<tr class="odd">
<td><h5 id="per-sample-or-rt-control">Per Sample or (+)RT Control</h5></td>
<td><h3 id="section"></h3></td>
<td><h5 id="per--rt-control">Per (-)RT Control</h5></td>
<td><h3 id="section-1"></h3></td>
</tr>
<tr class="even">
<td>5x RT Buffer</td>
<td>2 Âµl</td>
<td>5x RT Buffer</td>
<td>2 Âµl</td>
</tr>
<tr class="odd">
<td>2.5mM dNTP</td>
<td>4 Âµl</td>
<td>2.5mM dNTP</td>
<td>4 Âµl</td>
</tr>
<tr class="even">
<td>RNase Inhibitor (40 U/Âµl)</td>
<td>1 Âµl</td>
<td>RNase Inhibitor (40 U/Âµl)</td>
<td>1 Âµl</td>
</tr>
<tr class="odd">
<td>M-MLV Reverse Transcriptase</td>
<td>1 Âµl</td>
<td>H<sub>2</sub>O</td>
<td>1 Âµl</td>
</tr>
<tr class="even">
<td>Total Volume</td>
<td>8 Âµl</td>
<td>Total Volume</td>
<td>8 Âµl</td>
</tr>
</tbody>
</table>
<p>Note: When doing multiple reactions, make up a master mix for all
samples allowing 10% extra to permit for pipetting errors. Aliquot 8
Âµl/sample or control and add to the reaction mixture from step 2.</p></li>
<li><p> Add 8 Âµl of the RT Cocktail mix to the 12 Âµl of RNA mix. Mix by
pipetting up and down, centrifuge briefly.</p></li>
<li><p> Incubate at 42Â°C for 1 hour.</p></li>
<li><p> Centrifuge briefly and store at -20Â°C until ready to continue.</p></li>
</ol>
<p><strong><span class="underline"></span></strong></p><p><strong><span class="underline"></span></strong></p>
<h4>Polymerase Chain Reaction</h4>

<ol>
<li> For linear range PCR, we find it best to use 10 cycle-increments
plus controls.<br>
Controls are:

<ul>
<li>-a positive RT Control</li>
<li>-a negative PCR control to ensure no reagent contaminants</li>
<li>-a negative RT sample control (no M-MLV RT) to ensure the RNA
used is free of DNA contaminants.
The (+) RT and (-) PCR control can be use for an entire experiment,
for all conditions.<br>
The (-) RT sample controls, however, are needed per condition being
tested.</li>
</ul></li>
</ol>

<!-- end list -->

<ol>
<li> For each of the controls add 1 Âµl of the
following.
|     |                             |                                              |
| &mdash; | &mdash;&mdash;&mdash;&mdash;&mdash;&mdash;&mdash;&mdash;&mdash; | &mdash;&mdash;&mdash;&mdash;&mdash;&mdash;&mdash;&mdash;&mdash;&mdash;&mdash;&mdash;&mdash;&mdash;&ndash; |
| 1a. | Positive RT Control-Mock    | 1Âµl cDNA from RNA Control Template (Ambion) |
| 1b. | Negative PCR Control        | 1Âµl H<sub>2</sub>O                          |
| 2a. | Negative RT Control-Mock    | 1Âµl (-)RT Mock cDNA                         |
| 2b. | Negative RT Control-Treated | 1Âµl (-)RT Treated cDNA                      |</li>
</ol>
<p><strong><span class="underline"></span></strong></p><p><strong><span class="underline"></span></strong></p>
<h4>For Linear Range</h4>

<ol>
<li>For each sample, add 1 Âµl cDNA for a total of 50 Âµl.</li>
<li>Distribute 50 Âµl each into 10 separate tubes with each representing
a different cycle.</li>
<li>Set and run the following PCR cycles:

<ol>
<li> 95Â°C for 3 minutes<br>
start cycles:</li>
<li> 95Â°C for 45 seconds</li>
<li> 58Â°C for 45 seconds</li>
<li> 72Â°C for 45 seconds<br>
<strong>REPEAT from step &ldquo;b&rdquo; 35 times<br>
Note:</strong> Preheat thermocycler before placing the sample tubes in
the machine.</li>
</ol></li>
</ol>

<!-- end list -->

<ol>
<li>Remove the appropriate tube after the designated cycle is over.
Ideally you should run a final extension cycle in another
thermocycler (10 minutes at 72Â°C). Put on ice for 1 minute. Keep at
4Â°C until ready to load into gel. Store PCR product at -20Â°C.</li>
<li>Add 2.5 Âµl of dye to 10 Âµl of sample. Run samples on a 2% agarose
gel in 1x TAE buffer at 100 Volts until done or at 25 Volts
overnight. Stain gel with Ethidium Bromide or Sybr Green.</li>
<li>To image on Phosphoimager (Storm): for 100 ml gel, prepare 250 ml 1x
TAE buffer with 25 Âµl Sybr Green stain. (Stain the gel in 1:10,000
dilution Sybr Green stain in 1x TAE buffer.) Shake gently for at
least a hour. Sybr Green can be reused.<br>
<strong>Note:</strong> Keep the staining solution in the dark by wrapping the
container with aluminum foil.</li>
<li>Observe gel under UV light and photograph the image. Also, scan the
gel under STORM fluorimager.</li>
<li>Determine the optimal range by observing the linear range of the
gel. Take two points within the optimal range to continue on with
the Quantitative RT PCR.</li>
</ol>

<!-- end list -->

<ol>
<li>Observe gel under UV light and photograph the image. Also, scan the
gel under STORM Fluorimager to be able to analyze quantitative
differences.</li>
</ol>
<p><strong><span class="underline">Troubleshooting</span></strong></p>
<table>
<colgroup>
<col style="width: 50%" />
<col style="width: 50%" />
</colgroup>
<tbody>
<tr class="odd">
<td><strong>Problem</strong></td>
<td><strong>Solution</strong></td>
</tr>
<tr class="even">
<td><p>No Band</p></td>
<td><ul>
<li>Decrease stringency= lower annealing temperature or increase MgCl<sub>2</sub> concentration</li>
<li>Increase cycle number</li>
</ul></td>
</tr>
<tr class="odd">
<td><p>Too many bands</p></td>
<td><ul>
<li>Increase stringency: Higher annealing temp or decrease MgCl<sub>2</sub></li>
<li>Decrease cycle number</li>
<li>Perform hot start PCR</li>
<li>Decrease primer and/or template concentration</li>
</ul></td>
</tr>
<tr class="even">
<td><p>Wrong size band</p></td>
<td><ul>
<li>Raise annealing temp</li>
<li>Perform hot start PC</li>
</ul></td>
</tr>
<tr class="odd">
<td><p>Primer-dimers</p></td>
<td><ul>
<li>Set up reactions on ice and perform hot start PCR</li>
<li>Lower primer concentration (try 50-100 nM)</li>
</ul></td>
</tr>
<tr class="even">
<td><p>Band in negative RT lane</p></td>
<td><ul>
<li>Treat with DNase free</li>
<li>Design primers over several exons</li>
</ul></td>
</tr>
</tbody>
</table>


]]>
        </content>
    </entry>
    
    <entry>
        <title>Quantitative PCR</title>
        <link href="https://viroverse.washington.edu/protocols/microarrays/1054-Quantitative-PCR" rel="alternate" type="text/html" />
        <published>2010-04-01T16:14:14-07:00</published>
        <updated>2011-06-03T15:58:34+00:00</updated>
        <id>urn:uuid:a509c78c-9e4e-5616-a8c1-5791b0f15f23</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p>27 February 2002</p><p><span class="underline"><strong>Reagents:</strong></span></p>
<ul>
<li>Forward Gene Specific Primer (IDT)</li>
<li>Reverse Gene Specific Primer (IDT)</li>
<li>Random decamer primer (from Ambion RetroScript Kit: 1710,
$206.00/kit or Ambion, 5722G, $50.00/80Âµl)</li>
<li>RNase Inhibitor (from Ambion RetroScript Kit: 1710, $206.00/kit)</li>
<li>Reverse Transcriptase (M-MLV) (5x RT Buffer from Ambion RetroScript
Kit: 1710, $206.00/kit)</li>
<li>10x PCR Reaction Buffer (from Ambion RetroScript Kit: 1710,
$206.00/kit)</li>
<li>50 mM MgCl<sub>2</sub> (from Ambion RetroScript Kit: 1710,
$206.00/kit)</li>
<li>SuperTAQ DNA Polymerase (Ambion, 2050, $48.00/50 U or 2052,
$190.00/250U)</li>
<li>18S rRNA PCR Primer Pair (Ambion kit, 1716 $155.00/kit)</li>
<li>18S PCR Competimers (Ambion kit, 1716 $155.00/kit)</li>
<li>Sybr Green Stain (FMC Bioproduct, 50513, $146.00/box)</li>
</ul>
<p><strong><span class="underline">Protocol:</span></strong></p><p>Using the cDNA from the previous RT PCR, optimal cycles were determined
for gene of interest. The optimal 18S rRNA PCR Primer:Competimer ratio
will need to be optimized per gene primer pair (start with 1:9, 2:8, 3:7
and reduce ratio again if rare primer)</p>
<ol>
<li><p> Prepare of Primer Mixes (for desired gene) per reaction:  </p><p>Forward Primer 2 Âµl<br>
<span class="underline">Reverse Primer</span>
<span class="underline">2 Âµl</span><br>
Total Primer Mix 4 Âµl</p></li>
<li><p> Prepare of 10s rRNA PCR Primer:Competimer Mix (e.g., 1:9 Ratio):  </p><p>18 S rRNA PCR Primer 1Âµl<br>
<span class="underline">Competimer</span> <span class="underline">9
Âµl</span><br>
Total 1:9 Mix 10 Âµl</p></li>
<li><p> Prepare PCR Reaction Cocktail (ideal to include 4 controls):  </p><p>per reaction:<br>
10x Complete PCR Buffer 5 Âµl<br>
2.5 mM dNTP 4 Âµl<br>
Taq Polymerase 0.2 Âµl<br>
18 S Primer:Competimer Mix 4 Âµl<br>
<span class="underline">RNase-free H<sub>2</sub>O</span>
<span class="underline">4 Âµl</span><br>
Total 45 Âµl<br>
Mix by pipetting up and down, centrifuge briefly</p></li>
</ol>
<p><strong><span class="underline">For your Controls:</span></strong></p><p>Aliquot 45 Âµl into 4 PCR (0.2 ml) tubes marked C1, C2, C3, C4 (or
aliquot 180 Âµl (45 Âµl x 4) into a tube with 16ul 18 S primer pair and
aliquot 49 Âµl into 4 tubes)</p><p>Add 4 Âµl 18 S Primer pair to each tube then add 1 Âµl of the
following:<br>
C1 = 1 Âµl of (+) RT Control cDNA<br>
C2 = 1 Âµl of (-) RT Mock Control cDNA<br>
C3 = 1 Âµl of (-) RT LAU Control cDNA<br>
C4 = 1 Âµl of (-) PCR Control (ddH<sub>2</sub>O)<br>
Total reaction mix/tube per tube = 50 Âµl  </p><p>Add 4 Âµl of gene specific primer mix per cocktail mix. Mix well by
pipetting up and down.</p><p>Aliquot 49 Âµl into a PCR tubes</p><p>Add 1 Âµl of appropriate cDNA. and mix by pipetting up and down,
centrifuge briefly and keep on ice.</p><p>Close tube lid tightly and put into PCR machine at 95Â°C.</p><p>Run the tubes at the pre-determined optimal cycles per gene.</p><p>Perform PCR under the following conditions:</p>
<ol>
<li> 95Â°C for 3 minutes<br>
start cycles:</li>
<li> 95Â°C for 45 seconds</li>
<li> 58Â°C for 45 seconds (check annealing temp for gene)</li>
<li> 72Â°C for 45 seconds<br>
REPEAT for OPTIMAL CYCLES (pre-determined)</li>
<li> 72Â°C for 10 minutes</li>
<li> 4Â°C Forever</li>
</ol>
<p>Remove tubes at the appropriately designated cycle and kept on ice or at
4Â°C until gel can be run.</p><p>Analyze 10 Âµl PCR Product by mixing with 2.5 Âµl 5x dye in a 2% agarose
gel with 3.5 Âµl Ethinium Bromide in 1x TAE buffer.</p>
<ul>
<li>Run for 1.5 hours (or until ready) at 100V or overnight at 25V.</li>
<li>Stained gel with Sybr Green (250 Âµl 1x TAE and 25 Âµl Sybr Green)
for 1.5 hours while shaking.</li>
</ul>

<!-- end list -->

<ol>
<li>Observe gel under UV light and photograph the image. Also, scan the
gel under STORM Fluorimager to be able to analyze quantitative
differences.</li>
</ol>


]]>
        </content>
    </entry>
    
    <entry>
        <title>In Vitro Transcription</title>
        <link href="https://viroverse.washington.edu/protocols/microarrays/1194-In-Vitro-Transcription" rel="alternate" type="text/html" />
        <published>2010-04-01T16:13:28-07:00</published>
        <updated>2011-06-03T15:59:34+00:00</updated>
        <id>urn:uuid:43f2d57a-931f-5469-9c11-5a53e55b65d5</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p><strong>Reagents:</strong></p>
<ul>
<li><p>ddH<sub>2</sub>O</p></li>
<li><p>Phenol, water-saturated and buffered (pH 7.5)</p></li>
<li><p>Chloroform</p></li>
<li><p>G25 column</p></li>
<li><p>Linear acrylamide</p></li>
<li><p>3M Sodium Acetate pH 7.5 and pH 5.2</p></li>
<li><p>Ethanol</p></li>
<li><p>T7 polymerase with 5x reaction buffer and DTT</p></li>
<li><p>Nucleosides</p></li>
<li><p>RQ1 RNase-free DNase</p></li>
</ul>
<p><strong>Protocol:</strong></p><p><strong>A. Prepare template</strong></p>
<ol>
<li><p> Adjust volume of template PCR or linearized plasmid to 200 Âµl with
ddH<sub>2</sub>O</p></li>
<li><p> Phenol/Chloroform extract 3x with 100 Âµl P/C pH7.5</p></li>
<li><p> Pass through G25 column</p></li>
<li><p> Add:</p>
<ol>
<li><p> 1 Âµl linear acrylamide</p></li>
<li><p> 30 Âµl Sodium Acetate pH 7.5</p></li>
<li><p> 600 Âµl 100% Ethanol</p></li>
</ol></li>
<li><p> Mix, precipitate at -80Â°C for 15 minutes.</p></li>
<li><p> Spin 12 minutes at 14,000 rpm</p></li>
<li><p> Wash pellet with 70% Ethanol</p></li>
<li><p> Wash pellet with 100% Ethanol</p></li>
<li><p> Dry pellet for 10 minutes</p></li>
<li><p>Dissolve pellet in 11 Âµl ddH<sub>2</sub>O</p></li>
<li><p>Use 1 Âµl template to determine concentration.</p></li>
<li><p>Use 1.5 Âµg template in 10 Âµl ddH<sub>2</sub>O for transcription
reaction.</p></li>
</ol>

<h2>B. In vitro transcription reaction</h2>

<ol>
<li><p>Make reaction mix:</p>
<ol>
<li><p> 38 Âµl ddH<sub>2</sub>O</p></li>
<li><p> 20 Âµl 5x Buffer</p></li>
<li><p> 10 Âµl 100 mM DTT</p></li>
<li><p> 5 Âµl 10 mM rGTP</p></li>
<li><p> 5 Âµl 10 mM rATP</p></li>
<li><p> 5 Âµl 10 mM rUTP</p></li>
<li><p> 5 Âµl 10 mM rCTP</p></li>
<li><p> 1 Âµl RNase Inhibitor</p></li>
<li><p> 1 Âµl T7 polymerase</p></li>
</ol></li>
<li><p>Vortex, spin briefly</p></li>
<li><p>Add 10 Âµl template DNA, mix, spin briefly</p></li>
<li><p>Incubate for 1 hour at 40Â°C</p></li>
</ol>

<h1>C. Destroy DNA, purify RNA</h1>

<ol>
<li><p>Add 1 Âµl RQ1 RNase-free DNase</p></li>
<li><p>Incubate for 15 minutes at 40Â°C</p></li>
<li><p>Add 106 Âµl ddH<sub>2</sub>O</p></li>
<li><p>Sequentially add the following:</p>
<ol>
<li><p> 200 Âµl Phenol (water-saturated)</p></li>
<li><p> 40 Âµl Chloroform</p></li>
</ol></li>
<li><p>Vortex, spin for 5 minutes at 14,000 rpm</p></li>
<li><p>Pass the upper aqueous phase through G25 column</p></li>
<li><p>Precipitate with:</p>
<ol>
<li><p> 1 Âµl linear acrylamide</p></li>
<li><p> 30 Âµl 3M Sodium Acetate pH5.2</p></li>
<li><p> 600 Âµl 100% Ethanol</p></li>
</ol></li>
<li><p>Mix, precipitate at -80Â°C for 15 minutes.</p></li>
<li><p>Spin 15 minutes at 14,000 rpm</p></li>
<li><p>Wash pellet with 70% Ethanol</p></li>
<li><p>Wash pellet with 100% Ethanol</p></li>
<li><p>Dry pellet for 10 minutes</p></li>
<li><p>Dissolve pellet in 11 Âµl ddH<sub>2</sub>O</p></li>
<li><p>Use 1 Âµl to determine RNA concentration</p></li>
</ol>
<p>Svetlana Mikheeva, 13 August 1999</p>

]]>
        </content>
    </entry>
    
    <entry>
        <title>Plasmid Linearization</title>
        <link href="https://viroverse.washington.edu/protocols/molecular_biology/566-Plasmid-Linearization" rel="alternate" type="text/html" />
        <published>2010-04-01T16:12:49-07:00</published>
        <updated>2011-06-03T16:00:21+00:00</updated>
        <id>urn:uuid:61639385-35c7-526a-9f2e-732d174fa543</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p><strong>Reagents:</strong></p>
<ul>
<li><p>10X buffer</p></li>
<li><p>NotI</p></li>
<li><p>SalI</p></li>
<li><p>ddH<sub>2</sub>O</p></li>
<li><p>Agarose</p></li>
<li><p>Phenol</p></li>
<li><p>Chloroform</p></li>
<li><p>Ethanol</p></li>
<li><p>Glycogen</p></li>
<li><p>Sodium Acetate</p></li>
<li><p>Linear Acrylamide</p></li>
</ul>
<p><strong>Protocol:</strong></p><p>1. Prepare 10 Âµg plasmid DNA in 5 Âµl ddH<sub>2</sub>O</p><p>2. Add:</p><p>a. 165 Âµl ddH<sub>2</sub>O</p><p>b. 20 Âµl NE Buffer #3</p><p>c. 10 Âµl NotI</p><p>3. Vortex, spin briefly</p><p>4. Incubate overnight at 37Â°C</p><p>5. Run 1% agarose gel:</p><p>a. 10 Âµl of reaction (digested plasmid)</p><p>b. 1 Âµl undigested plasmid</p><p>c. 1.6 Âµl 1kb ladder</p><p>d. 2.0 Âµl phi-x174 ladder</p><p>6. Continue if plasmid was cut completely</p><p>7. Do phenol/chlorofom extraction with 100 Âµl P/C pH 7.5</p><p>8. Pass top layer over G25 column</p><p>9. Add:</p><p>a. 1 Âµl glycogen</p><p>b. 30 Âµl 3M Sodium Acetate pH 7.5</p><p>c. 600 Âµl 100% Ethanol</p><p>10. Mix, precipitate for 20 minutes at -80Â°C</p><p>11. Spin 12 minutes at 14,000rpm</p><p>12. Wash pellet with 70% Ethanol</p><p>13. Wash pellet with 100% Ethanol</p><p>14. Dry pellet for 5 minutes</p><p>15. Dissolve pellet in 170 Âµl ddH<sub>2</sub>O</p><p>16. Add:</p><p>a. 20 Âµl NE Buffer for SalI</p><p>b. 10 Âµl SalI</p><p>17. Vortex, spin briefly</p><p>18. Incubate for 2 hours at 37Â°C</p><p>19. Run 1% agarose gel:</p><p>a. 6 Âµl of reaction (digested plasmid)</p><p>b. 1 Âµl undigested plasmid</p><p>c. 1 Âµl 1kb ladder</p><p>d. 1.4 Âµl phi-x174 ladder</p><p>20. Continue if plasmid was cut completely (2 bands)</p><p>21. Do phenol/chlorofom extraction with 100 Âµl P/C pH 7.5</p><p>22. Pass top layer over G25 column</p><p>23. Add:</p><p>a. 1 Âµl linear acrylamide</p><p>b. 30 Âµl 3M Sodium Acetate pH 7.5</p><p>c. 600 Âµl 100% Ethanol</p><p>24. Mix, precipitate for 20 minutes at -80Â°C</p><p>25. Wash pellet with 70% Ethanol</p><p>26. Wash pellet with 100% Ethanol</p><p>27. Dry pellet for 5 minutes</p><p>28. Dissolve pellet in 11 Âµl ddH<sub>2</sub>O</p><p>Svetlana Mikheeva, 13 August 1999</p>

]]>
        </content>
    </entry>
    
    <entry>
        <title>Aminoallyl labeling</title>
        <link href="https://viroverse.washington.edu/protocols/microarrays/2150-Aminoallyl-labeling" rel="alternate" type="text/html" />
        <published>2010-04-01T16:11:49-07:00</published>
        <updated>2011-06-03T16:01:46+00:00</updated>
        <id>urn:uuid:c31f0932-3796-5bab-8b76-de8d6cabbfd4</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p><strong>Protocol for Amino-allyl Reverse Transcription and NHS-Cy Dye
Labeling</strong></p><p>**<br>
**</p><p><strong>MATERIALS</strong></p>
<h1>Equipment</h1>
<p>- Single channel pipette: 0.5-10 Âµl, 10-100 Âµl, 200-1000 Âµl,
Eppendorf</p><p>- Vacuum manifold, Millipore</p><p>- Speedvac</p><p>- Adjustable waterbaths (37Â° C, 42Â° C, 55Â° C, 100Â° C)</p><p><strong>Disposables</strong></p><p>- 96-well Multiscreen-FB filter plate, Millipore, MAFB NOB 10</p><p>- Catch plate, VWR, 622409-108</p><p>- Pipette tips: 1-10 Âµl, 2-20 Âµl, 20-200 Âµl, 200-1000 Âµl, ART</p><p>- Tubes: 1.5ml</p><p><strong>Reagents</strong></p><p>- Anchored dT25, dT<sub>23</sub>VN, 8 ÂµM stock GibcoBRL</p><p>- Random 9-mers, NNNNNNNNN, 1 Âµg/Âµl stock Gibco-BRL</p><p>- GFP poly A<sup>+</sup> RNA, prepared from plasmid pSP64-GFP</p><p>- SuperScript II, GibcoBRL, 200 U/Âµl, 18064-022 (includes 5X First
Strand Buffer and DTT)</p><p>- Nucleotides, Pharmacia 27-2035-02, 100mM each*</p><p>- 5-(3-Aminoallyl)-2&#39;-deoxyurindine 5&#39;-triphosphate sodium salt
(AA-dUTP), Sigma A-0410</p><p>- RNase Inhibitor, Boehringer Mannheim 799 017, 40U/ml</p><p>- Buffers, Sigma, 2.5M NaOH, 2M MOPS, 1M Tris-HCl pH 7.5 8.5</p><p>- 4M Hydroxylamine, Sigma H-2391</p><p>- 0.1M NaBicarbonate pH 9.0</p><p>- Monofunctional NHS-ester Cy3/Cy5, APBiotech PA23001/PA25001;
resuspend each tube in 72Âµl H<sub>2</sub>O, aliquot 4.5Âµl into 16
tubes, dry in speedvac</p><p>- Millipore Binding Buffer (5.3M Gua-HCl in 150mM KAc, pH 4.8)</p><p>- Millipore Wash Solution (80% Ethanol)</p><p>- Slide pretreatment buffer, 5XSSC/0.2%SDS</p><p>- Hybridization Buffer (50% Formamide, 5X SSC, 5X Denhardtï¿½s,
0.1%SDS, 100Âµg/ml ssDNA (Sigma), 100Âµg/ml COT-I DNA (BRL), 100Âµg/ml
polyA<sub>72</sub>)</p><p>- Wash buffers, 1XSSC/0.2%SDS, 0.1XSSC/0.2%SDS, 0.1XSSC</p><p>* Nucleotide mix (20X): 10mM GTP, 10mM ATP, 10mM CTP, 4mM TTP, 4mM
AA-dUTP</p>
<hr>
<p><strong>PROTOCOL</strong></p>
<h1>Reverse Transcription</h1>
<p>- Mix together:</p><p>2 Âµg poly A<sup>+</sup> RNA (or 50mg total RNA)</p><p>2 Âµl oligo dT<sub>23</sub>VN (8 mM)</p><p>2 Âµl random 9-mers (1mg/ml)</p><p>2.5 ng GFP poly A<sup>+</sup> RNA</p><p>10.5 Âµl total volume</p><p>- Incubate at 70Â° C for 10 minutes, chill on ice 30 seconds, spin</p><p>- Add the following:</p><p>4 Âµl 5X First Strand Buffer</p><p>2 Âµl DTT (0.1M)</p><p>1 Âµl Nucleotide Mix (10mM G/A/C, 4mM T, 4mM AA-dUTP)</p><p>1 Âµl H<sub>2</sub>O</p><p>0.5 Âµl RNase Inhibitor</p><p>- Mix contents of tube gently and incubate at RT for 10 minutes</p><p>- Add 1 Âµl SuperScriptII</p><p>20 Âµl total reaction volume</p><p>- Mix contents of tube gently and incubate at 42Â°C for 2 hours</p><p><strong>RNA hydrolysis and purification of cDNA</strong></p><p>- Add 2 Âµl 2.5 M NaOH</p><p>- Incubate at 37Â°C for 10 minutes</p><p>- Add 10 Âµl 2 M MOPS</p><p>- Add 200 Âµl binding buffer to probe and mix</p><p>- Dispense into glass fiber filter plate</p><p>- Place filter plate on top of vacu-system and apply vacuum.</p><p>- Wash 6x with 80% fresh Ethanol</p><p>- Place filter plate on top of catch plate along with centrifuge
alignment frame</p><p>- Do one dry spin to remove residual ethanol (3500 rpm, 5ï¿½)</p><p>- Add 50 Âµl H<sub>2</sub>O. Incubate 1 minute at RT</p><p>- Place filter plate on top of a clean catch plate along with a
centrifuge alignment frame and spin (3000 rpm, 5ï¿½)</p><p>- Repeat with another 50 Âµl H<sub>2</sub>O</p><p>- Scan probe at OD 260nm, 550nm and 650nm.</p><p>- Dry in Speedvac until volume is less than 5Âµl (~45 minutes @
50ï¿½C)</p>
<h1>Coupling to NHS-ester Cy dyes</h1>
<p>- Adjust volume of sample to 4.5Âµl</p><p>- Resuspend mono-functional NHS-ester Cy3 or Cy5 dye aliquot in 4.5Âµl
of 0.1M NaBicarbonate Buffer pH 9.0</p><p>- Mix dye and cDNA</p><p>- Incubate 1 hr at RT (Note: there is no advantage to incubating
longer)</p><p>Quenching the Reaction and Removal of uncoupled Cy dyes</p><p>- Add 4.5Âµl of 4M Hydroxylamine</p><p>- Add 16.5Âµl of H<sub>2</sub>O to bring the volume to 30Âµl</p><p>- Add 150Âµl of Millipore binding buffer, purify as above in Millipore
96 well plate, elute twice in 50Âµl aliquots of H<sub>2</sub>O</p><p>- Scan probe at OD 260nm, 550nm and 650nm and calculate probe yield,
incorporated Cy-dye and specific activity</p><p>- Purify probe over G50 column (prespin column (3000 rpm 1ï¿½),
transfer to new tube, apply probe, spin (3000rpm 2ï¿½), collect
flow-through).</p><p>- Dry purified probe down in speedvac (~1.5 hours at 50 Â°C)</p>
<h1>Hybridization</h1>
<p>- Slide pretreatment: submerge mirrored slides for 40 minutes in
5XSSC/0.2%SDS at 55 Â°C (waterbath), rinse slide by two quick dips in
ddH<sub>2</sub>O, air dry. Rinse coverslip in ddH<sub>2</sub>O and
ethanol, air dry</p><p>- Resuspend dried down probe in Hybridization Buffer (25Âµl/reaction)</p><p>- Boil probe for 3 minutes, ice 30 seconds, spin briefly</p><p>- Apply probe to slide and cover with coverslip</p><p>- Incubate overnight (14-16 hrs) at 42 Â°C in humid chamber</p><p>- Preheat wash buffers to 55 Â°C</p><p>- Remove coverslip by immersing slide in 1XSSC/0.2%SDS</p><p>- Wash in 1XSSC/0.2% SDS for 10 minutes at RT</p><p>- Wash twice in 0.1XSSC/0.2%SDS at RT for 10 minutes</p><p>- Wash twice in 0.1XSSC at RT for 1 minute</p><p>- Rinse by two quick dips in ddH<sub>2</sub>O, dry with compressed air</p><p>- Scan (PMT 700, green (532nm), filter 1; PMT700, red (633nm), filter
2; width 10mm, length 60mm).</p>

]]>
        </content>
    </entry>
    
    <entry>
        <title>CY-DYE PROBE Synthesis</title>
        <link href="https://viroverse.washington.edu/protocols/microarrays/1810-CY-DYE-PROBE-Synthesis" rel="alternate" type="text/html" />
        <published>2010-03-30T16:26:06-07:00</published>
        <updated>2011-06-03T16:01:59+00:00</updated>
        <id>urn:uuid:7c168c15-fd05-54cb-8b84-17df8469028b</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<h2>Reagents:</h2>

<table>
<thead>
<tr>
<th></th>
<th></th>
</tr>
</thead>

<tbody>
<tr>
<td>Anchored dT25</td>
<td>Amersham, 8 ÂµM, RPK0145, quote 7G-3709, $110</td>
</tr>
<tr>
<td><em>or</em> Anchored dT25</td>
<td><em>or</em> dT<sub>23</sub>VN, 8 ÂµM, GibcoBRL</td>
</tr>
<tr>
<td>Random 9-mers</td>
<td>5&#39; NNN NNN NNN 3&#39;, 1 Âµg/Âµl, GibcoBRL</td>
</tr>
<tr>
<td>GFP poly A<sup>+</sup> RNA</td>
<td>prepared from plasmid pSP64-GFP</td>
</tr>
<tr>
<td>SuperScript II</td>
<td>GibcoBRL, 200 U/Âµl, 10000 units, 18064-014, $177</td>
</tr>
<tr>
<td>5X First Strand Buffer</td>
<td>GibcoBRL, included with enzyme</td>
</tr>
<tr>
<td>DTT</td>
<td>GibcoBRL, included with enzyme</td>
</tr>
<tr>
<td>Nucleotides*</td>
<td>Pharmacia, 100mM each, 27-2035-02, $00</td>
</tr>
<tr>
<td>or Nucleotides*</td>
<td>Promega, 10mmol each, U1330, $75</td>
</tr>
<tr>
<td>Cy3-dCTP</td>
<td>Amersham, 25nmol, PA53023, quote 1A-3709, $151</td>
</tr>
<tr>
<td>Cy5-dCTP</td>
<td>Amersham, 25nmol, PA55023, quote 1A-3709, $151</td>
</tr>
<tr>
<td>RNase Inhibitor</td>
<td>Boehringer Mannheim, 40U/ml, 799 017, $00</td>
</tr>
<tr>
<td>or Rnasin</td>
<td>Promega, 2500 units, N2511, $82</td>
</tr>
<tr>
<td>NaOH</td>
<td>Sigma, 2.5M, $00</td>
</tr>
<tr>
<td>MOPS</td>
<td>Sigma, 2M, $00</td>
</tr>
<tr>
<td>Glass fiber filter plate</td>
<td>Millipore, MAFB NOB 10, 10/pack, $134</td>
</tr>
<tr>
<td>Catch Plate</td>
<td>VWR, 622409-108, 50/pack, $00</td>
</tr>
<tr>
<td>Binding buffer</td>
<td>5.3M Gua-HCl in 150mM Kac pH 4.8 with glacial acetic acid (3-4ml/500ml)</td>
</tr>
<tr>
<td>Tris-HCl</td>
<td>Sigma, 10mM pH 8.0, T-3038, $00</td>
</tr>
<tr>
<td>Ethanol</td>
<td>Stores, 80%, $00</td>
</tr>
<tr>
<td>ProbeQuant G50</td>
<td>Amersham, 27-5335-01, 50/pack, $145</td>
</tr>
<tr>
<td>Coverslips</td>
<td>VWR, 24x60mm, 48393-106, $15.92</td>
</tr>
<tr>
<td>Deionized Formamide</td>
<td>Sigma, 100mL, F-9037, $23.60</td>
</tr>
<tr>
<td>20X SSC</td>
<td>Ambion, 1L, 9763, $30</td>
</tr>
<tr>
<td>50X Denhardtï¿½s</td>
<td>Fisher, 500g, BP515-5, $42.40</td>
</tr>
<tr>
<td>10% SDS</td>
<td>Ambion, 500ml, 9822, $40</td>
</tr>
<tr>
<td>Human CotI DNA</td>
<td>GibcoBRL, 500 units, 15279-011, $75</td>
</tr>
<tr>
<td>Poly A<sub>72</sub></td>
<td>5ï¿½ A<sub>72</sub> 3ï¿½, GibcoBRL</td>
</tr>
<tr>
<td>Wash buffers</td>
<td>1XSSC/0.2%SDS, 0.1XSSC/0.2%SDS, 0.1XSSC</td>
</tr>
</tbody>
</table>
<p>* Nucleotide mix: always use 10mM dGTP/dATP/dTTP and 1mM dCTP;
unlabeled dCTP used in 1:1 ratio with Cy-labeled dCTP.</p>
<h2>CY-DYE PROBE SYNTHESIS (17 February 2001)</h2>
<p><span class="underline">Protocol:</span></p>
<ol>
<li>Mix together:</li>
</ol>
<p>2 Âµg mRNA</p><p>2 Âµl oligo dT<sub>23</sub>VN (8 ÂµM)</p><p>2 Âµl random 9-mers (1 Âµg/Âµl)</p><p><span class="underline"></span> <span class="underline">1 Âµl GFP mRNA
(1 ng/Âµl)</span></p><p>10.5 Âµl total volume</p>
<ol>
<li><p>Heat to 70Â°C for 10 minutes.</p></li>
<li><p>Chill on ice for 30 seconds.</p></li>
<li><p>Centrifuge briefly.</p></li>
<li><p>Add the following:</p></li>
</ol>
<p>4 Âµl 5X First Strand Buffer</p><p>2 Âµl DTT (0.1 M)</p><p>1 Âµl Nucleotide Mix (10 mM G/A/T, 1 mM C)</p><p>1 Âµl Cy3- or Cy5-dCTP (1 mM)</p><p>0.5 Âµl RNase Inhibitor</p><p>Note: when doing multiple reactions, make up premix containing all but
Cy-dyes and aliquot 7.5 Âµl premix to each tube before adding Cy-dyes.</p>
<ol>
<li><p>Mix contents of tube gently and incubate at RT for 10 minutes.</p></li>
<li><p>Add</p></li>
</ol>
<p><span class="underline">1 Âµl</span> SuperScriptII</p><p>20 Âµl total reaction volume</p>
<ol>
<li><p>Mix contents of tube gently and incubate at 42Â°C for 2-3 hours.</p></li>
<li><p>Denature cDNA/mRNA hybrid as follows:</p></li>
</ol>
<p>Add 2 Âµl 2.5 M NaOH</p><p>Incubate at 37Â°C for 10 minutes</p><p>Add 10 Âµl 2 M MOPS</p>
<ol>
<li><p>Add 200 Âµl binding buffer to probe and mix.</p></li>
<li><p>Dispense into glass fiber filter plate.</p></li>
<li><p>Place filter plate on top of vacu-system and apply vacuum.</p></li>
<li><p>Wash 6x with 200 ml 80% Ethanol.</p></li>
<li><p>Place filter plate on top of catch plate along with centrifuge
alignment frame.</p></li>
<li><p>Do one dry spin to remove residual ethanol (3500 rpm, 5 min).</p></li>
<li><p>Add 50 Âµl 10 mM Tris-HCl, pH 8. Incubate 1 minute at RT.</p></li>
<li><p>Place filter plate on top of a <strong>clean</strong> catch plate along with a
centrifuge alignment frame and spin (3000 rpm, 5 min).</p></li>
<li><p>Repeat with another 50 Âµl Tris-HCl.</p></li>
<li><p>Scan probe at OD 260 nm, 550 nm and 650 nm and calculate probe
yield, incorporated Cy-dye and specific activity.</p></li>
<li><p>Purify probe over G50 column (prespin column (1000x g 1 min),
transfer to new tube, apply probe, spin (1000x g 2 min), collect
flow-through).</p></li>
<li><p>Dry purified probe down in speedvac (1 hour at 50Â°C).</p></li>
<li><p>Rinse slides and coverslips by two quick dips in ddH<sub>2</sub>O,
air dry.</p></li>
<li><p>Resuspend dried-down probe in 25 Âµl volume of hybridization
solution (50% formamide, 5x SSC, 5x Denhardtï¿½s, 0.1% SDS, 100 Âµg/ml
poly A<sub>72</sub>, 100 Âµg/ml human CotI DNA; pass through 0.2 Âµm
filter).</p></li>
<li><p>Boil probe for 3 minutes, ice 30 seconds, spin briefly.</p></li>
<li><p>Combine with appropriate reaction; total volume is now 50 Âµl.</p></li>
<li><p>Apply probe to slide and cover with coverslip.</p></li>
<li><p>Incubate overnight (14-16 hrs) at 42Â°C in humid chamber.</p></li>
<li><p>Preheat wash buffers to 55Â°C.</p></li>
<li><p>Remove coverslip by immersing slide in 1x SSC/0.2% SDS.</p></li>
<li><p>Wash in 1x SSC/0.2% SDS for 10 minutes at RT.</p></li>
<li><p>Wash twice in 0.1x SSC/0.2% SDS at RT for 10 minutes.</p></li>
<li><p>Wash twice in 0.1x SSC at RT for 1 minute.</p></li>
<li><p>Rinse by two quick dips in ddH<sub>2</sub>O</p></li>
<li><p>Dry with compressed air.</p></li>
<li><p>Scan (PMT 600, green (532nm), filter 1; PMT650, red (633nm), filter
2; width 10mm, length 60mm).</p></li>
</ol>
<p>PS. Name Fluorescence Solution</p><p>Cy3 = green = pink</p><p>Cy5 = red = blue</p>

]]>
        </content>
    </entry>
    
    <entry>
        <title>Northern Transfer</title>
        <link href="https://viroverse.washington.edu/protocols/microarrays/1894-Northern-Transfer" rel="alternate" type="text/html" />
        <published>2010-03-30T16:25:00-07:00</published>
        <updated>2011-06-03T16:02:40+00:00</updated>
        <id>urn:uuid:264e69fb-10b2-5b48-90ca-084a86df4b55</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p><span class="underline"><strong>Reagents</strong>:</span></p><p>20X SSC (3M NaCl, 0.3M NaCitrate, pH 7.0):</p>
<table>
<thead>
<tr>
<th></th>
<th></th>
<th></th>
</tr>
</thead>

<tbody>
<tr>
<td></td>
<td>1000ml</td>
<td>2000ml</td>
</tr>
<tr>
<td>NaCl</td>
<td>175g</td>
<td>350g</td>
</tr>
<tr>
<td>Na<sub>3</sub>citrate.2H<sub>2</sub>O</td>
<td>88g</td>
<td>176g</td>
</tr>
</tbody>
</table>
<p>- adjust pH to 7.0 with 1M HCl</p><p>100X Denhardt:</p>
<table>
<thead>
<tr>
<th></th>
<th></th>
<th></th>
</tr>
</thead>

<tbody>
<tr>
<td></td>
<td>100ml</td>
<td>500ml</td>
</tr>
<tr>
<td>Ficoll-400</td>
<td>2g</td>
<td>10g</td>
</tr>
<tr>
<td>Polyvinyl-pyrrolidone</td>
<td>2g</td>
<td>10g</td>
</tr>
<tr>
<td>Bovine Serum Albumin</td>
<td>2g</td>
<td>10g</td>
</tr>
<tr>
<td>ddH<sub>2</sub>O</td>
<td>to 100ml</td>
<td>to 500ml</td>
</tr>
</tbody>
</table>
<p>- filter sterilize</p><p>- store at ï¿½20 Â°C in 25ml aliquots</p><p>Hyb Solution (5X SSC, 5X Denhardt, 50% Formamid, 1% SDS)</p>
<table>
<thead>
<tr>
<th></th>
<th></th>
<th></th>
<th></th>
<th></th>
</tr>
</thead>

<tbody>
<tr>
<td></td>
<td>5ml</td>
<td>10ml</td>
<td>15ml</td>
<td>20ml</td>
</tr>
<tr>
<td>20X SSC</td>
<td>1.25ml</td>
<td>2.5ml</td>
<td>3.75ml</td>
<td>5.0ml</td>
</tr>
<tr>
<td>100X Denhardt</td>
<td>0.25ml</td>
<td>0.5ml</td>
<td>0.75ml</td>
<td>1.0ml</td>
</tr>
<tr>
<td>di-Formamid</td>
<td>2.50ml</td>
<td>5.0ml</td>
<td>7.50ml</td>
<td>10.0ml</td>
</tr>
<tr>
<td>10% SDS</td>
<td>0.50ml</td>
<td>1.0ml</td>
<td>1.50ml</td>
<td>2.0ml</td>
</tr>
<tr>
<td>ssDNA (11mg/ml)</td>
<td>50ml</td>
<td>100ml</td>
<td>150ml</td>
<td>200ml</td>
</tr>
<tr>
<td>ddH<sub>2</sub>O</td>
<td>0.45ml</td>
<td>0.9ml</td>
<td>1.35ml</td>
<td>1.8ml</td>
</tr>
</tbody>
</table>
<p><span class="underline"><strong>Protocol</strong>:</span></p>
<ol>
<li> Rinse gel with ddH<sub>2</sub>0, 3X.</li>
<li> Soak in 20X SSC for 45 minutes.</li>
<li> Take photograph of gel.</li>
<li> Soak nylon membrane -cut to size- in ddH<sub>2</sub>O for 5 minutes.</li>
<li> Put sponge in container, fill with 20X SSC halfway up sponge.</li>
<li> Put 3 20X SSC-soaked GB002-sheets on top of sponge.</li>
<li> Place gel on top, remove bubbles.</li>
<li> Cover with nylon membrane, remove bubbles.</li>
<li> Successively add 1 GB002, 4 GB003 and 4cm GB004.</li>
<li>Cover with glass plate and 0.4kg weight.</li>
<li>Transfer overnight.</li>
<li>Take structure apart, mark wells on membrane.</li>
<li>Visualize and mark rRNA bands and RNA MW ladder on membrane.</li>
<li>Rinse membrane in 2X SSC.</li>
<li>Dry on GB003 and wrap in plastic foil</li>
<li>UV cross-link (ï¿½Autolinkï¿½ on Stratalinker).</li>
<li>Take photograph of flattened gel to assess transfer efficiency.</li>
<li>Pre-hybridize membrane for 4-20 hours in 5-10 ml Formamid (Pre-)
Hybridization solution (FPH) at 42 Â°C.</li>
<li>Boil 100Âµl probe for 10 minutes (use 1 x 10<sup>6</sup> cpm/ml
FPH).</li>
<li>Cool on ice, spin.</li>
<li>Add to hybridization bag.</li>
<li>Incubate 20 hours at 42 Â°C.</li>
<li>Rinse in 2X SSC/0.1% SDS at RT, 3X.</li>
<li>Wash in 0.2X SSC/0.1% SDS for 15 minutes at 42 Â°C, 2X.</li>
<li>Wash in 0.1X SSC/0.1% SDS for 15 minutes at 65 Â°C, 2X.</li>
<li>Rinse in 2X SSC.</li>
<li>Wrap in plastic foil.</li>
<li>Expose to phosphoscreen.</li>
</ol>
<p><span class="underline"><strong>Notes</strong>:</span></p>
<ul>
<li><p>After overnight exposure 5pg RNA can be detected with a probe
labeled to a specific activity of 10<sup>9</sup> dpm/mg.</p></li>
<li><p>Probes labeled to â‰¥5 x 10<sup>8</sup> dpm/Âµg should detect
transcripts that represent 0.01% of mRNA population with a blot of
10 Âµg total RNA or 0.0002% of mRNA population with a blot of 3 Âµg
poly(A)<sup>+</sup> RNA.</p></li>
<li><p>For stripping poor boiling 0.05% SDS on membrane, incubate for 10
minutes, repeat up to 3X. Rinse with 2X SSC.</p></li>
</ul>


]]>
        </content>
    </entry>
    
    <entry>
        <title>Hot Asymmetric PCR (Katze Lab)</title>
        <link href="https://viroverse.washington.edu/protocols/microarrays/2603-Hot-Asymmetric-PCR-Katze-Lab" rel="alternate" type="text/html" />
        <published>2010-03-30T16:24:14-07:00</published>
        <updated>2011-06-03T16:03:43+00:00</updated>
        <id>urn:uuid:edf99773-ca7c-54af-b53b-e018f98ea279</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p>Primary PCR should be performed with the Unigene forward and reverse
primers. Purify PCR product using Millipore MAFBNOB10 plates. Elute in
water, and use the purified product as a template in the next reaction.
Note that you use only one primer (VNG26), in order to make the
complementary strand alone. This is a linear, asymmetric PCR reaction.</p><p><strong><span class="underline">Combine reagents listed below</span>:</strong></p><p>Primer VNG26 (30 ÂµM) 1.0 Âµl</p><p>Template (100ng) 3.0 Âµl</p><p>10x PCR Buffer 5.0 Âµl</p><p>MgCl<sub>2</sub> (25mM) 3.0 Âµl</p><p>10X dNTPï¿½s<sup>*</sup> 5.0 Âµl</p><p><sup>32</sup> P dCTP (~10 ÂµCi/Âµl) 10.0 Âµl</p><p>Water 22.8 Âµl</p><p>Taq polymerase <span class="underline">0.2 Âµl</span></p><p>Final Volume 50.0 Âµl</p><p>*10X dNTP stock: 2 mM dGTP/dATP/dTTP and 12 ÂµM dCTP. Final
concentration in the PCR reaction is: 0.2 mM dGTP/dATP/dTTP, and 0.0012
mM dCTP. Recipe: combine 5 Âµl 10mM dGTP, 5 Âµl 10mM dATP, 5 Âµl 10mM
dTTP and 10 Âµl 30 ÂµM dCTP for 25 Âµl total volume.</p><p><strong><span class="underline">PCR cycles</span>:</strong></p><p>5 min at 95Â°C 1X</p><p>45 sec at 95Â°C</p><p>45 sec at 50Â°C 40X</p><p>4 min at 72Â°C</p><p>10 min at 72Â°C 1X</p><p>hold at 4Â°C</p><p>Purify the hot PCR product over a G50 column.</p><p>Count 1 Âµl: PCR counts should range ~2-3 x 10<sup>6</sup> cpm/Âµl</p><p><strong>(PRE) HYBRIDIZING THE PCR PROBE</strong></p><p><strong><span class="underline">Prehybridization:</span></strong></p>
<ol>
<li><p> Place blot in hybridization tube: add 6-10ml prehyb/hyb solution.</p></li>
<li><p> Place tube in 42Â°C, preheated, hybridization oven. Turn rotator to
the ï¿½8ï¿½ setting. Always include a balance tube.</p></li>
<li><p> Incubate for 3-6
hours.</p></li>
</ol>
<p><strong><span class="underline">Hybridization</span></strong><span class="underline">:</span></p>
<ol>
<li><p> Boil labeled probe for 2 minutes. Chill on ice for 2 minutes, and
add to the hybridization solution. Mix well before pouring the
solution into the tube containing the blot. Use 6ml of solution with
at least 2 x 10<sup>6</sup> cpm/Âµl of probe (best to use entire
probe for 6ml hyb, i.e. 2 x 10<sup>7</sup> cpm/Âµl).</p></li>
<li><p> Pour prehybridization solution out of the hybridization tube and add
the hybridization solution containing the probe.</p></li>
<li><p> Incubate in the hybridization oven at 42Â°C, rotating, overnight.</p></li>
<li><p> Rinse blot 1X quickly at room temp in 2xSSC/0.05%SDS.</p></li>
<li><p> Wash 1X for 20 minutes at room temp in 2xSSC/0.05% SDS.</p></li>
<li><p> Wash 1X for 30 minutes at 50Â°C in 0.1xSSC/0.1% SDS.</p></li>
<li><p>Wrap in Saran while the blot is still damp, and expose with a
phosphor image
screen.</p></li>
</ol>

<h1><span class="underline">Purchasing Bacterial Clones for Northern Verification:</span></h1>
<p>Purchase the clones by their <strong>IMAGE ID</strong> number. The vendor is Research
Genetics (phone number 1-800-533-4363) The cost is $45 for sequence
verified clones.</p><p>Search engine with more clone info:
<a href="http://www.resgen.com/resources/apps/cdna/index.php3">http://www.resgen.com/resources/apps/cdna/index.php3</a> (Type in the
IMAGE ID).</p><p>Image website: <a href="http://image.llnl.gov/">http://image.llnl.gov/</a></p>

]]>
        </content>
    </entry>
    
    <entry>
        <title>Radiolabeling DNA Probe for Northerns</title>
        <link href="https://viroverse.washington.edu/protocols/microarrays/2216-Radiolabeling-DNA-Probe-for-Northerns" rel="alternate" type="text/html" />
        <published>2010-03-30T16:23:14-07:00</published>
        <updated>2011-06-03T16:03:55+00:00</updated>
        <id>urn:uuid:aaed912a-ef3c-58c0-b283-7407c022f548</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p><span class="underline"><strong>Reagents</strong></span></p>
<ul>
<li><p>25-50ng of target DNA in no more than 25Âµl TE buffer.</p></li>
<li><p>Ready.To.Go DNA Labelling Kit (-dCTP), Pharmacia, 27-9251-01</p></li>
<li><p>ProbeQuant G-50 Micro Columns, Pharmacia, 27-5335-01</p></li>
<li><p>ddH<sub>2</sub>O</p></li>
<li><p>5ml scintillation fluid in vial.</p></li>
</ul>
<p><span class="underline"><strong>Protocol</strong></span></p>
<h3>Probe synthesis</h3>
<p>1. Reconstitute the contents of the Reaction Mix tube by adding 20Âµl
ddH<sub>2</sub>O. DO NOT MIX. Let sit on ice for 5-60 minutes.</p><p>2. Denature 25-50ng DNA by heating for 2-3 minutes at 95-100 Â°C.
Immediately place on ice for 2 minutes, then centrifuge briefly.</p><p>3. Add the following to the reconstituted Reaction Mix tube:</p><p>Denatured DNA (25-50ng) 25Âµl</p><p>[a-32P]dCTP (3000 Ci/mmol) 5Âµl (50ÂµCi)</p><p>ddH<sub>2</sub>O to total of 50Âµl</p><p>4. Mix by gently pipetting up and down several times. Bubbles may be
removed by a pulse centrifugation.</p><p>5. Incubate at 37 Â°C for 5-15 minutes. (Difficult templates may
require up to 30 minutes.)</p><p>Note: The Reaction Mix contains dATP, dGTP, dTTP, FPLC-pure Klenow
fragment (4-8 units) and random oligonucleotides, primarily 9-mers.</p>
<h3>Probe purification</h3>
<p>6. Resuspend the resin in spin column by vortexing.</p><p>7. Loosen the cap one-fourth and snap off the bottom closure.</p><p>8. Place the column in a 1.5ml screw-cap tube.</p><p>9. Pre-spin the column for 1 minute at 735 x g (3500rpm).</p><p>10. Place the column in a new 1.5ml tube and slowly apply 50Âµl of the
sample to the top-center of the resin without disturbing the resin-bed.</p><p>11. Spin the column at 735 x g for 2 minutes. The purified probe is
collected in the bottom of the support tube. Cap the tube. Store at
ï¿½20 Â°C until use.</p><p>Note: For a force of 735 x g the appropriate speed can be calculated
from the following formula: rpm = (1000) (657/r)<sup>&frac12;</sup> . For
example with a rotor radius of 73mm, the appropriate speed would be
3000rpm.</p>
<h3>Probe quantification</h3>
<p>12. Resuspend 1Âµl of purified probe in 50Âµl ddH<sub>2</sub>O.</p><p>13. Transfer mixture to a vial with 5ml scintillation fluid.</p><p>14. Count the samples (as user 7, T-wing).</p><p>Note: this protocol should label 25-50ng of DNA to 1 x 10<sup>9</sup>
dpm/Âµg. Yields are usually 10<sup>6</sup> cpm/Âµl.</p>
<h3>Probe qualification</h3>
<p>15. Run 20,000 cpm probe on a 1% Agarose gel.</p><p>16. Place gel on 4 pieces of Whatman paper.</p><p>17. Cover just the gel with piece of Saran Wrap.</p><p>18. Dry down gel at 65 Â°C for 1 hour.</p><p>19. Expose phosphoscreen.</p><p>Note: PCR products should give one sharp band.</p>

]]>
        </content>
    </entry>
    
    <entry>
        <title>RNA-Gel for Northern Transfer</title>
        <link href="https://viroverse.washington.edu/protocols/microarrays/133-RNA-Gel-for-Northern-Transfer" rel="alternate" type="text/html" />
        <published>2010-03-30T16:22:31-07:00</published>
        <updated>2011-06-03T16:04:02+00:00</updated>
        <id>urn:uuid:d548737d-ee45-5e00-b075-b4b6dbcd2371</id>
        <author><name>Camille</name></author>
        <content type="html">
<![CDATA[
<p><strong><span class="underline">Reagents:</span></strong></p><p>Reduced Formaldehyde denaturing gel (1% Agarose, 1x MOPS, 1.9%
di-F)</p>
<table>
<thead>
<tr>
<th></th>
<th></th>
<th></th>
<th></th>
</tr>
</thead>

<tbody>
<tr>
<td><span class="underline"></span></td>
<td><span class="underline">20 ml</span></td>
<td>80 ml</td>
<td>100 ml</td>
</tr>
<tr>
<td>Agarose</td>
<td>0.2 g</td>
<td>0.8 g</td>
<td>1.2 g</td>
</tr>
<tr>
<td>25x MOPS</td>
<td>800 ul</td>
<td>3.2 ml</td>
<td>4.0 ml</td>
</tr>
<tr>
<td>H<sub>2</sub>O</td>
<td>18 ml</td>
<td>73 ml</td>
<td>91 ml</td>
</tr>
<tr>
<td>di-Formaldehyde</td>
<td>1.0 ml</td>
<td>4.0 ml</td>
<td>5.1 ml</td>
</tr>
</tbody>
</table>
<p>25x MOPS (2 M MOPS, 500 mM NaOAc, 10 mM EDTA)ddH<sub>2</sub>O</p>
<table>
<thead>
<tr>
<th></th>
<th></th>
<th></th>
<th></th>
</tr>
</thead>

<tbody>
<tr>
<td></td>
<td>50 ml</td>
<td>200 ml</td>
<td>400 ml</td>
</tr>
<tr>
<td>MOPS</td>
<td>20.91 g</td>
<td>83.65 g</td>
<td>167.3 g</td>
</tr>
<tr>
<td>NaOAc</td>
<td>3.40 g</td>
<td>13.6 g</td>
<td>27.2 g</td>
</tr>
<tr>
<td>EDTA</td>
<td>0.19 g</td>
<td>0.75 g</td>
<td>1.50 g</td>
</tr>
<tr>
<td>ddH<sub>2</sub>O</td>
<td>to 50 ml</td>
<td>to 200 ml</td>
<td>to 400 ml</td>
</tr>
</tbody>
</table>
<p>Denaturing Buffer (1x MOPS, 50% Formamide, 2% Formaldehyde)</p>
<table>
<thead>
<tr>
<th></th>
<th></th>
<th></th>
<th></th>
<th></th>
</tr>
</thead>

<tbody>
<tr>
<td></td>
<td>150 Âµl</td>
<td>200 Âµl</td>
<td>750 Âµl</td>
<td>1500 Âµl</td>
</tr>
<tr>
<td>25x MOPS</td>
<td>6 ml</td>
<td>8 ml</td>
<td>30 ml</td>
<td>60 ml</td>
</tr>
<tr>
<td>di-Formamide</td>
<td>75 ml</td>
<td>100 ml</td>
<td>375 ml</td>
<td>750 ml</td>
</tr>
<tr>
<td>di-Formaldehyde</td>
<td>8 ml</td>
<td>11 ml</td>
<td>40 ml</td>
<td>80 ml</td>
</tr>
<tr>
<td>ddH<sub>2</sub>O</td>
<td>61 ml</td>
<td>81 ml</td>
<td>305 ml</td>
<td>610 ml</td>
</tr>
</tbody>
</table>
<p>Blue Juice (50% Glycerol, 0.27% BPB/XC, 1.3 mM EDTA)</p>
<table>
<thead>
<tr>
<th></th>
<th></th>
<th></th>
</tr>
</thead>

<tbody>
<tr>
<td></td>
<td>1 ml</td>
<td>2 ml</td>
</tr>
<tr>
<td>Glycerol</td>
<td>0.5 ml</td>
<td>1.0 ml</td>
</tr>
<tr>
<td>Bromophenol Blue</td>
<td>2 mg</td>
<td>4 mg</td>
</tr>
<tr>
<td>Xylene Cyanol</td>
<td>2 mg</td>
<td>4 mg</td>
</tr>
<tr>
<td>0.5 M EDTA</td>
<td>2 ml</td>
<td>4 ml</td>
</tr>
<tr>
<td>ddH<sub>2</sub>O</td>
<td>498 ml</td>
<td>996 ml</td>
</tr>
</tbody>
</table>
<p>Ethidium Bromide (1mg/ml)</p><p>ï¿½ Blue Juice and Ethidium Bromide are added in 2:1 ratio.</p><p>ï¿½ 100 ml gel: 50 Âµl sample (6 Âµl RNA + 30 Âµl denaturing buffer + 9
Âµl BJ/EB)</p><p><strong><span class="underline">Protocol:</span></strong></p>
<ol>
<li><p> Dissolve agarose in MOPS and H<sub>2</sub>O, cool to handwarm.</p></li>
<li><p> Add 37% di-Formaldehyde, poor gel, let solidify.</p></li>
<li><p> Flush wells after removal of comb.</p></li>
<li><p> Running buffer is 1x MOPS.</p></li>
<li><p> Add denaturing buffer to RNA samples in 5:1 ratio.</p></li>
<li><p> Incubate at 65Â°C for 15 minutes.</p></li>
<li><p> Cool on ice.</p></li>
<li><p> Add Blue Juice/Ethidium Bromide (2:1) to samples in 1:4 ratio.</p></li>
<li><p> Load on gel (max. 15 Âµl on 20ml gel, max. 50 Âµl on 100ml gel).</p></li>
<li><p>Run for 3 hrs at 75V.</p></li>
</ol>
<p><strong>Notes:</strong></p><p>- Run 6 Âµg of RNA MW ladder along with samples.</p><p>- Optional: run <sup>32</sup>P labelled l/<em>Hin</em>dIII (10000 cpm) with
samples.</p>

]]>
        </content>
    </entry>
    

    
</feed>